Sheep growth hormone releasing hormone gene and its expression product and application
A growth hormone and hormone-releasing technology, which can be used in sugar derivatives, drug combinations, medical preparations containing active ingredients, etc., and can solve the problems of short half-life and inconvenient production.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0116] Embodiment 1, the construction of expression clone
[0117] 1. Construction elements of expression cloning
[0118] 1. 5' flanking nucleotide sequence
[0119] The 5' flanking nucleotide sequence was transformed from the bovine skeletal muscle actin promoter
[0120] Primers were designed as follows:
[0121] up: CTGGGGAGGAGGGTTTCGTATGT
[0122] LENGTH: 23nt ΔG=-3.6kcal / mol (G+C)%=56.5% Tm=72
[0123] Low: TCTGGTTTCTGCAAGGACAGG
[0124] SnaBI
[0125] LENGTH: 28nt ΔG=-6.9kcal / mol (G+C)%=50.0% Tm=72
[0126] The following is a comparison of the 5' flanking nucleotide sequence obtained by PCR with the above primers and the reported bovine skeletal muscle actin promoter sequence (GENEBANK sequence number is U02285), and the homology is 99%.
[0127] Upper line: 5' flanking nucleotide sequence obtained by PCR with the above primers
[0128] from 1 to 2445
[0129] Lower line: Reported bovine skeletal muscle actin promoter
[0130] ...
Embodiment 2
[0304] Embodiment 2, expression plasmid promotes sheep growth in vivo
[0305] Injection method: 1.2-1.5 mg / head of the expression plasmid of the present invention is injected into the muscles on both sides of the buttocks once. The growth-promoting effect after injection is shown in Table 2.
[0306] For the specific operation method in this example, refer to the corresponding part in the "Molecular Cloning Experiment Guide" (Second Edition) published by Science Press. In the experiment, half of rams and half of ewes were divided into random groups. The feeding method is basically grazing, and the concentrate is rarely supplemented.
[0307] Variety
character
Xinjiang Kazakh sheep
Mongolian Ujimqin sheep
Shandong Small Tail Han Sheep
control group
control group
control group
Head count
15
20
12
22
20
25
Bod...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
