Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of interferon regulatory factor 5 (irf5) and its inhibitors in the treatment of cardiac hypertrophy

A myocardial hypertrophy and inhibitor technology, which can be used in gene therapy, cardiovascular system diseases, and microbial determination/examination. The effect of worsening cardiac function and promoting cardiac hypertrophy

Active Publication Date: 2019-10-11
WUHAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In T cells, the loss of IRF5 leads to Th1 cell response impairment, the expression of IL-12p35 and iNOS is significantly down-regulated, and the IRF5-deficient mice cannot resist the infection of Leishmania donovani[8]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of interferon regulatory factor 5 (irf5) and its inhibitors in the treatment of cardiac hypertrophy
  • Application of interferon regulatory factor 5 (irf5) and its inhibitors in the treatment of cardiac hypertrophy
  • Application of interferon regulatory factor 5 (irf5) and its inhibitors in the treatment of cardiac hypertrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Construction of Heart-specific IRF5 Gene Knockout Mice and IRF5 Transgenic Mice

[0053] 1. Construction of heart-specific IRF5 gene knockout mice (for construction strategy see figure 1 )

[0054] Construction of cardiac-specific IRF5 gene knockout mice using CRISPR-Cas9 technology. First, design a CRISPR targeting site in intron 2 and 3 of the mouse IRF5 gene through the online CRISPR design tool (http: / / crispr.mit.edu). The target sequences are:

[0055] IRF5-sgRNA 1: GGCAAGCAGGTACAATTCTCAA AGG,

[0056] IRF5-sgRNA 2: GGCAGTGGTAATGAAGAAGCACC TGG.

[0057] In addition, a donor vector (Donor Vector) for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle and two loxp sequences in the same direction.

[0058] (1) Construction of the targeting vector: the two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into the pUC57-sgRNA vector treated with restriction endonuclea...

Embodiment 2

[0081] The expression of embodiment 2IRF5 in the heart of normal person and patient with cardiomyopathy

[0082] Normal human hearts (individuals donated by non-cardiac causes of death) and recipients replaced by heart transplantation patients with dilated cardiomyopathy) were used to conduct SDS-PAGE-Western Blot experiments (Western Blot) on proteins extracted from the hearts, and the binding specificity Antibodies that recognize IRF5 were detected to measure the expression of IRF5, and GAPDH was used as an internal reference. Test results such as image 3 As shown, the expression of IRF5 was significantly upregulated in the hearts of patients with dilated cardiomyopathy.

Embodiment 3

[0083] Embodiment 3 Obtaining of myocardial hypertrophy model

[0084] 1. Grouping of experimental animals: A model of myocardial hypertrophy was established by aortic coarctation (AB). Randomly divided into 10 groups, grouped as follows: control group mice sham operation group (α-MHC-MCM Sham, IRF5-flox Sham) and AB operation group (α-MHC-MCM AB, IRF5-floxAB), IRF5 gene knockout group Mouse sham operation group (IRF5-CKO Sham) and AB operation group (IRF5-CKO AB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), heart-specific IRF5 transgenic mouse sham group Surgery group (TG Sham) and AB surgery group (TGAB).

[0085] 2. The myocardial hypertrophy model adopts aortic arch coarctation (AB) surgery, and the operation process of the model is as follows:

[0086] 2.1 Preoperative preparation

[0087] (1) Anesthesia: weigh the mice first, calculate the required amount of anesthetic (3% pentobarbital sodium) according to 90 mg / kg body weigh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an interferon regulatory factor 5(IRF5) and an inhibitor thereof in treating cardiac hypertrophy, and belongs to the filed of function and application of genes. The application of the interferon regulatory factor 5(IRF5) and the inhibitor thereof in treating cardiac hypertrophy determines the relationships between the expression of IRF5 genes and cardiac hypertrophy disease. The relationships are inhibiting the expression of the IRF5 genes, accordingly remarkably inhibiting cardiac hypertrophy and fibrosis, and improving cardiac function; promoting the expression of the IRF5 genes, accordingly remarkably promoting cardiac hypertrophy and fibrosis, and deteriorating cardiac function. Thereby, IRF5 can be adopted as a drug target used for screening drugs which protect cardiac function, prevent, relieve and / or treat cardiac hypertrophy and resist myocardial fibrosis. The inhibitor of IRF5 can be used for preparing drugs which protect cardiac function, prevent, relieve and / or treat cardiac hypertrophy and resist myocardial fibrosis.

Description

technical field [0001] The invention belongs to the field of gene function and application, and relates to the application of Interferon Regulatory Factor-5 (Interferon Regulatory Factor-5, IRF5) as a drug target in the screening of drugs for treating myocardial hypertrophy, and the use of IRF5 inhibitors in the preparation of drugs for treating myocardial hypertrophy in the application. Background technique [0002] Myocardial hypertrophy is the compensatory hyperplasia of the heart in response to various stimuli. It is characterized by increased cardiomyocyte volume and increased heart mass. It is one of the independent cardiovascular risk factors and eventually leads to heart failure and even sudden death. A variety of stimuli can lead to myocardial hypertrophy, mainly including mechanical stretch, pressure load, and various neurohumoral factors (such as ischemia, hypoxia, NO deficiency, inflammatory factors, etc.) [1]. The main pathological changes include cardiomyocyte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61K48/00A61P9/00C12Q1/02
Inventor 李红良邓克穷黄赞
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com