Application of interferon regulatory factor 5 (irf5) and its inhibitors in the treatment of cardiac hypertrophy
A myocardial hypertrophy and inhibitor technology, which can be used in gene therapy, cardiovascular system diseases, and microbial determination/examination. The effect of worsening cardiac function and promoting cardiac hypertrophy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Construction of Heart-specific IRF5 Gene Knockout Mice and IRF5 Transgenic Mice
[0053] 1. Construction of heart-specific IRF5 gene knockout mice (for construction strategy see figure 1 )
[0054] Construction of cardiac-specific IRF5 gene knockout mice using CRISPR-Cas9 technology. First, design a CRISPR targeting site in intron 2 and 3 of the mouse IRF5 gene through the online CRISPR design tool (http: / / crispr.mit.edu). The target sequences are:
[0055] IRF5-sgRNA 1: GGCAAGCAGGTACAATTCTCAA AGG,
[0056] IRF5-sgRNA 2: GGCAGTGGTAATGAAGAAGCACC TGG.
[0057] In addition, a donor vector (Donor Vector) for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle and two loxp sequences in the same direction.
[0058] (1) Construction of the targeting vector: the two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into the pUC57-sgRNA vector treated with restriction endonuclea...
Embodiment 2
[0081] The expression of embodiment 2IRF5 in the heart of normal person and patient with cardiomyopathy
[0082] Normal human hearts (individuals donated by non-cardiac causes of death) and recipients replaced by heart transplantation patients with dilated cardiomyopathy) were used to conduct SDS-PAGE-Western Blot experiments (Western Blot) on proteins extracted from the hearts, and the binding specificity Antibodies that recognize IRF5 were detected to measure the expression of IRF5, and GAPDH was used as an internal reference. Test results such as image 3 As shown, the expression of IRF5 was significantly upregulated in the hearts of patients with dilated cardiomyopathy.
Embodiment 3
[0083] Embodiment 3 Obtaining of myocardial hypertrophy model
[0084] 1. Grouping of experimental animals: A model of myocardial hypertrophy was established by aortic coarctation (AB). Randomly divided into 10 groups, grouped as follows: control group mice sham operation group (α-MHC-MCM Sham, IRF5-flox Sham) and AB operation group (α-MHC-MCM AB, IRF5-floxAB), IRF5 gene knockout group Mouse sham operation group (IRF5-CKO Sham) and AB operation group (IRF5-CKO AB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), heart-specific IRF5 transgenic mouse sham group Surgery group (TG Sham) and AB surgery group (TGAB).
[0085] 2. The myocardial hypertrophy model adopts aortic arch coarctation (AB) surgery, and the operation process of the model is as follows:
[0086] 2.1 Preoperative preparation
[0087] (1) Anesthesia: weigh the mice first, calculate the required amount of anesthetic (3% pentobarbital sodium) according to 90 mg / kg body weigh...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com