DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and method and application for identifying orobanche coerulescens
A barcode and small column technology, which is applied in the field of DNA barcode identification and small column identification, can solve the problems of identification limitations of small column, achieve short identification time, high repeatability, and high detection accuracy Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] The molecular identification of embodiment 1 Xiaoliedang
[0020] A DNA barcode for identifying Xiaoliedang, the DNA barcode is a section of ITS2 gene, the sequence of the ITS2 gene is shown in SEQ ID NO.1;
[0021] cacatcgcgt tgccctcact ccctcccctt cttacggggc gtgtttttgg tgggggcggataatggcctc ccgtgcacaa taatgtgcgg ctggtccaaa tgcgaacccg cggcgactca cgtcacgaccagtggtggtt gaatcttcaa ctctcgtctg tcgtgtcgga tggtgttgca tgttgcgctc tattatagacccataggcac gagctacttg tgctttcgac tgcg(SEQ ID NO.1)。 The primer sequences for PCR amplification of the above ITS2 gene can be: SEQ ID NO.2 and SEQ ID NO.3.
[0022] Collected and imported plant products from Fujian, Xinjiang and other places respectively intercepted Liedang plants of 12 individuals belonging to 4 species of Liedang, and the 12 identified samples were Xiao Liedang, Xiao Liedang, Xiao Liedang, Gualiedang , Melon column, melon column, elbow column, elbow column, elbow column, branch column, branch column, branch column. Please ref...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap