Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and method and application for identifying orobanche coerulescens

A barcode and small column technology, which is applied in the field of DNA barcode identification and small column identification, can solve the problems of identification limitations of small column, achieve short identification time, high repeatability, and high detection accuracy Effect

Active Publication Date: 2017-03-22
INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Relying on traditional morphological taxonomy methods has limitations in the identification of Xiao Liedang

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and method and application for identifying orobanche coerulescens
  • DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and method and application for identifying orobanche coerulescens
  • DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and method and application for identifying orobanche coerulescens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The molecular identification of embodiment 1 Xiaoliedang

[0020] A DNA barcode for identifying Xiaoliedang, the DNA barcode is a section of ITS2 gene, the sequence of the ITS2 gene is shown in SEQ ID NO.1;

[0021] cacatcgcgt tgccctcact ccctcccctt cttacggggc gtgtttttgg tgggggcggataatggcctc ccgtgcacaa taatgtgcgg ctggtccaaa tgcgaacccg cggcgactca cgtcacgaccagtggtggtt gaatcttcaa ctctcgtctg tcgtgtcgga tggtgttgca tgttgcgctc tattatagacccataggcac gagctacttg tgctttcgac tgcg(SEQ ID NO.1)。 The primer sequences for PCR amplification of the above ITS2 gene can be: SEQ ID NO.2 and SEQ ID NO.3.

[0022] Collected and imported plant products from Fujian, Xinjiang and other places respectively intercepted Liedang plants of 12 individuals belonging to 4 species of Liedang, and the 12 identified samples were Xiao Liedang, Xiao Liedang, Xiao Liedang, Gualiedang , Melon column, melon column, elbow column, elbow column, elbow column, branch column, branch column, branch column. Please ref...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular identification, in particular to a DNA (Deoxyribonucleic Acid) bar code for identifying orobanche coerulescens, and a method and application for identifying the orobanche coerulescens. The method for identifying the orobanche coerulescens comprises the following steps of utilizing PCR (Polymerase Chain Reaction) for amplifying an ITS2 sequence of a sample to be tested and sequencing, wherein a PCR primer amplification sequence of an ITS2 gene is SEQ ID NO.2 and SEQ ID NO.3; and if a 16bp basic group is T, a 28bp basic group is C, a 30bp basic group is T, a 32bp basic group is T, a 35bp basic group is C, and a 187bp basic group is C, determining the sample to be tested is the orobanche coerulescens. Compared with a traditional morphological and micro-morphological identification method and a DNA fingerprint marker, the method provided by the invention utilizes the ITS2 sequence for identifying the orobanche coerulescens, and an identification result can be directly obtained through carrying out PCR amplification and sequencing on the ITS2 sequence, so that the testing accuracy is high, the repeatability is high, and the identification time is short.

Description

technical field [0001] The invention relates to the technical field of molecular identification, in particular to a DNA barcode for identifying xiaoliedang and a method and application for identifying xiaoliedang. Background technique [0002] Xiaoliedang Orobanche minor Sm. is included in the "List of Imported Plant Quarantine Pests of the People's Republic of China", and it is a quarantine weed in my country. It is also included in the list of poisonous and harmful weeds by the United States, Australia and the Czech Republic. Regarded as quarantine or Class A noxious weeds. The weed is a vicious parasitic plant, which makes the crops unable to grow healthily, and can cause severe production reduction of beans, tobacco and other crops. Small Liedang is native to Europe, West Asia and North Africa, and later spread to North America, Oceania and other places, causing serious economic losses all over the world. [0003] Orobanche ramosa L., Orobanche ramosa L., O. aegyptiaca ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2600/156C12Q2563/185
Inventor 于文涛林阳武陈智明过赋文王念武
Owner INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More