Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Establishing method and applications of dianthus chinensis l flower color regulation key enzyme gene CHS silencing system

A technology of key enzyme gene and establishment method, which is applied in the field of establishment of CHS silencing system for key enzyme gene regulation of Dianthus flower color

Inactive Publication Date: 2017-04-12
INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

VIGS (virus-induced gene silence, VIGS) technology has been applied to a variety of plants for gene function verification, how to use this technology to study carnation flower color gene has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishing method and applications of dianthus chinensis l flower color regulation key enzyme gene CHS silencing system
  • Establishing method and applications of dianthus chinensis l flower color regulation key enzyme gene CHS silencing system
  • Establishing method and applications of dianthus chinensis l flower color regulation key enzyme gene CHS silencing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] In order to make the objects and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0025] The embodiment of the present invention provides a method for establishing a CHS silencing system for regulating the key enzyme gene of Dianthus flower color, including the following steps:

[0026] S1. Extract mRNA from carnation seedling leaves, use the reverse-transcribed cDNA as a template, design primers according to the conserved sequence of Carnation CHS gene, and use Forward: GTCGCTTCATGCCTCTACCAAC and Reverse: GCTAGGACTGAACGCATCCTC to amplify by RT-PCR to obtain a 407bp amplification product ( figure 1 )

[0027] S2, the obtained fragment of 407bp size was connected to pGEM T-easy for sequencing and sequence alignment was carri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an establishing method and applications of a dianthus chinensis l flower color regulation key enzyme gene CHS silencing system. According to the establishing method, mRNA is extracted from dianthus chinensis l seedling leaf, reverse transcription cDNA is used as a template, primers are designed according to the conserved sequence of a dianthus caryophyllus CHS gene, amplification is performed through RT-PCR by using the designed primers to obtain an amplification product having 407 bp, the obtained fragment having 407 bp is linked to pGEM T-Easy to obtain a CHS fragment, the obtained CHS fragment is subjected to enzyme digestion with EcoRI, the digested CHS fragment is linked to a TRV2 vector being subjected to the same enzyme digestion to obtain recombinant plasmid pTRV2 / DcCHS407, and the obtained recombinant plasmid pTRV2 / CHS407 is transformed into GV3101 Agrobacterium. According to the present invention, the flower color gene function can be quickly and effectively verified, and the corresponding traits can be obtained after the dianthus chinensis l flower bud is infected.

Description

technical field [0001] The invention relates to the field of flower biotechnology, in particular to a method for establishing and an application of a CHS silencing system for regulating the key enzyme gene of dianthus flower color. Background technique [0002] Dianthus is a plant of the genus Dianthus in the family Caryophyllaceae, native to China. Because of its many colors, it is widely used in flower beds and ground covers. Study the regulation mechanism of Dianthus flower color and obtain related genes, which can be used for the genetic improvement of flower color of plants of the same genus, increase the types of plants used in northern gardens, and achieve the purpose of beautifying the environment. Dianthus takes 2-3 months from sowing to flowering. Therefore, the rapid and effective verification of the gene functions controlling these flower colors is of great significance for the future research and application of flower color inheritance and breeding of Dianthus p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/00
CPCC12N15/8218C12N15/825
Inventor 贺学勤刘佳王志达
Owner INNER MONGOLIA AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com