Establishing method and applications of dianthus chinensis l flower color regulation key enzyme gene CHS silencing system
A technology of key enzyme gene and establishment method, which is applied in the field of establishment of CHS silencing system for key enzyme gene regulation of Dianthus flower color
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] In order to make the objects and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0025] The embodiment of the present invention provides a method for establishing a CHS silencing system for regulating the key enzyme gene of Dianthus flower color, including the following steps:
[0026] S1. Extract mRNA from carnation seedling leaves, use the reverse-transcribed cDNA as a template, design primers according to the conserved sequence of Carnation CHS gene, and use Forward: GTCGCTTCATGCCTCTACCAAC and Reverse: GCTAGGACTGAACGCATCCTC to amplify by RT-PCR to obtain a 407bp amplification product ( figure 1 )
[0027] S2, the obtained fragment of 407bp size was connected to pGEM T-easy for sequencing and sequence alignment was carri...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com