Antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition
A derivative, antibacterial peptide technology, applied in the preservation, antibacterial, and application of food ingredients as antimicrobials, can solve problems such as poor thermal or acid-base stability, limited antibacterial properties, and limited active applications.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] Embodiment 1, the preparation of antibacterial lipopeptide bacaucin and its antibacterial activity
[0103] The present invention isolates a strain of bacteria from the soil, uses the primer pair AGAGTTTGATCCTGGCTCAG (sequence 1) and ACGGCTACCTTGTTACGACTT (sequence 2)) designed at both ends of 16S rRNA to perform PCR amplification on the 16S rRNA of the bacterial strain, and the 16S rRNA of the amplified product The sequence of the rRNA is shown in sequence 3 in the sequence table, and the sequence analysis result of the strain 16S rRNA is shown in figure 1 As shown, the sequence of the 16S rRNA was found to indicate that the bacterial strain was Bacillus subtilis (Bacillus subtilis), and the bacterial strain was named Bacillus subtilis (CAU21).
[0104] Bacillus subtilis (CAU21), the cells are rod-shaped, with a diameter of 0.6 μm to 1.0 μm and a length of 1.5 μm to 2.0 μm. The spores are elliptical, the cysts are not enlarged, and the Gram reaction is positive. The ...
Embodiment 2
[0138] Embodiment 2, the preparation of antibacterial lipopeptide bacaucin derivative and its antibacterial activity
[0139] The antimicrobial lipopeptide bacaucin of Example 1 is optimized to obtain various bacaucin derivatives (bacaucin Derivatives), namely Bacaucin-1~Bacaucin-16, Bacaucin-1 is a small molecule polypeptide, and other derivatives of Bacaucin Bacaucin-2~Bacaucin-16 All are polypeptides, in which Bacaucin-8 is a cyclic polypeptide, the fifth position of Bacaucin-10 is ornithine (Orn) residue, the N-terminal of Bacaucin-12 is modified by Ac, the amino acid sequence of Bacaucin-1~Bacaucin-16 They are sequences 4-19 in the sequence list, and the specific information is as follows Figure 4 Shown, wherein 1 to 16 represent Bacaucin-1~Bacaucin-16, respectively.
[0140] Bacaucin-1~Bacaucin-16 were synthesized by Shanghai Gil Biochemical Co., Ltd. After synthesis, the purity and molecular weight of these several bacaucin derivatives were determined by high-performa...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap