Antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition

A derivative, antibacterial peptide technology, applied in the preservation, antibacterial, and application of food ingredients as antimicrobials, can solve problems such as poor thermal or acid-base stability, limited antibacterial properties, and limited active applications.

Active Publication Date: 2017-05-10
CHINA AGRI UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the antibacterial properties of most small molecular polypeptides are limited to in vitro antibacterial activity, poor stability to heat or acid and alkali, and poor stability to proteases, which greatly limits their activity in vivo and in the field of disease treatment. Applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition
  • Antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition
  • Antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Embodiment 1, the preparation of antibacterial lipopeptide bacaucin and its antibacterial activity

[0103] The present invention isolates a strain of bacteria from the soil, uses the primer pair AGAGTTTGATCCTGGCTCAG (sequence 1) and ACGGCTACCTTGTTACGACTT (sequence 2)) designed at both ends of 16S rRNA to perform PCR amplification on the 16S rRNA of the bacterial strain, and the 16S rRNA of the amplified product The sequence of the rRNA is shown in sequence 3 in the sequence table, and the sequence analysis result of the strain 16S rRNA is shown in figure 1 As shown, the sequence of the 16S rRNA was found to indicate that the bacterial strain was Bacillus subtilis (Bacillus subtilis), and the bacterial strain was named Bacillus subtilis (CAU21).

[0104] Bacillus subtilis (CAU21), the cells are rod-shaped, with a diameter of 0.6 μm to 1.0 μm and a length of 1.5 μm to 2.0 μm. The spores are elliptical, the cysts are not enlarged, and the Gram reaction is positive. The ...

Embodiment 2

[0138] Embodiment 2, the preparation of antibacterial lipopeptide bacaucin derivative and its antibacterial activity

[0139] The antimicrobial lipopeptide bacaucin of Example 1 is optimized to obtain various bacaucin derivatives (bacaucin Derivatives), namely Bacaucin-1~Bacaucin-16, Bacaucin-1 is a small molecule polypeptide, and other derivatives of Bacaucin Bacaucin-2~Bacaucin-16 All are polypeptides, in which Bacaucin-8 is a cyclic polypeptide, the fifth position of Bacaucin-10 is ornithine (Orn) residue, the N-terminal of Bacaucin-12 is modified by Ac, the amino acid sequence of Bacaucin-1~Bacaucin-16 They are sequences 4-19 in the sequence list, and the specific information is as follows Figure 4 Shown, wherein 1 to 16 represent Bacaucin-1~Bacaucin-16, respectively.

[0140] Bacaucin-1~Bacaucin-16 were synthesized by Shanghai Gil Biochemical Co., Ltd. After synthesis, the purity and molecular weight of these several bacaucin derivatives were determined by high-performa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses antimicrobial lipopeptide bacaucin derivatives and application thereof in bacterial infection inhibition. The antimicrobial lipopeptide bacaucin derivatives disclosed by the invention are polypeptides shown as SEQ ID No. 4 and SEQ ID No. 9-18 or derivatives thereof. The experiment proves that the bacaucin derivatives disclosed by the invention have effects of inhibiting bacteria, particularly bacaucin-1 has a specific effect on inhibiting staphylococcus aureus, and the minimum inhibitory concentration is 4mu g/mL; and moreover, the derivatives do not have any cytotoxic effect on Vero, Hep-2 and A549, are not hemolytic, have excellent histocompatibility and do not have any toxic effect on zebrafish embryos. The bacaucin derivatives have effects on inhibiting Gram positive bacteria and Gram negative bacteria and can be used for inhibiting bacteria.

Description

technical field [0001] The invention relates to the antibacterial lipopeptide bacaucin derivative and its application in inhibiting bacterial infection in the field of biotechnology. Background technique [0002] The large-scale use of antibiotics began in the 1940s and played a decisive role in the treatment of bacterial infections, saving countless lives. Because low-dose antibiotics can promote animal growth, some antibiotics are added to feed as antibacterial growth promoters (antibiotic growth promoters, AGPs) and are widely used around the world. In the modern farming industry characterized by scale and intensification, antibiotics play an irreplaceable role in the prevention and control of animal diseases, ensuring sufficient food supplies such as meat, eggs, and milk. Especially when the management level of my country's aquaculture industry is low and the degree of intensification is not high, antibiotics have played an extremely important role in reducing animal di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/06C12N15/11A61K38/08A61P31/04A23L3/3526
CPCA23B4/20A23L3/3526A23V2002/00A61K38/00C07K7/06A23V2200/10A23V2250/55
Inventor 朱奎丁双阳沈建忠刘源崔一芳刘晓晔夏曦
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap