Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid detection kit and method for legionella pneumophila ST1 strain

A technology of Legionella pneumophila and a kit is applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc. High performance, improved detection efficiency, and accurate detection results

Inactive Publication Date: 2017-05-24
GUANGZHOU KINGMED DIAGNOSTICS CENT
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection method still cannot detect ST1 strains of Legionella pneumophila

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid detection kit and method for legionella pneumophila ST1 strain
  • Rapid detection kit and method for legionella pneumophila ST1 strain
  • Rapid detection kit and method for legionella pneumophila ST1 strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1, primer

[0048] The invention provides a primer for Legionella pneumophila ST1 strain.

[0049] Table 1 Primers provided by the present invention

[0050]

Embodiment 2

[0051] Embodiment 2, the pairing of primer and its amplified fragment size

[0052] The present invention adopts the Legionella genus specific primer pair amplified fragment provided in Example 1 is 388bp, the Legionella pneumophila species-specific primer amplified fragment is 229bp, and Legionella pneumophila is the ST1 type bacterial strain specific primer amplified fragment is 104bp and 134bp fragments.

[0053] Table 2 The pairing of primers and the size of their amplified fragments

[0054]

[0055]

[0056] in:

[0057] (1) The nucleotide sequence amplified by GL-388F and GL388-R primers is:

[0058] GGAGGCAGCAGTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTGAGGGTTGTAAAGCACTTTCAGTGGGGAGGAGGGTTAATAGGTTAAGAGCTGATTAACTGGACGTTACCCACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTGATTAAGTTATCTGTGAAATTCCTGGGCTTAACCTGGGACGGTCAGATAATACTGGTTGACTCGAGTATGGGAGAGGGTAGTGGAATTTCCGGTGTAGCGGTGAAATGCGTAGAGATCGGAAGG...

Embodiment 3

[0065] Embodiment 3, the method for rapid detection of Legionella pneumophila ST1 strain

[0066] 1) Apply the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA in the specimen to be tested: select the specimen for pretreatment, and then use the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA, wherein the composition of the DNA extraction solution is as follows:

[0067] Composition of DNA Extraction Solution concentration Chelex 100 resin 5% mass concentration Tris-HCl, pH 8.3 10mM EDTA-Na 2 (Disodium EDTA)

0.1mM NaN3 (sodium azide) 0.1% mass concentration Protease-K (Protease K) 200μg / ml

[0068]2) using the bacterial genome DNA as a template, using the Legionella specific primers described in Example 1, the Legionella pneumophila species specific primers, and the Legionella pneumophila ST1 strain primers to carry out multiple PCR amplification; the PCR reaction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of microbial molecule detection and particularly relates to a rapid detection kit and method for a legionella pneumophila ST1 strain. A primer for rapid detection of the legionella pneumophila ST1 strain, provided by the invention, comprises a legionella specific primer, a legionella pneumophila specific primer and a legionella pneumophila ST1 strain specific primer. The primer provided by the invention has the advantages of being strong in specificity and high in accuracy; when multiple PCR is performed by utilizing four primers, whether legionella exists or not can be detected in a reaction system, and the detected legionella can be divided into legionella pneumophila or non legionella pneumophila. The detected legionella pneumophila can also be identified as a high-pathogenicity ST1 type epidemic strain. The rapid detection method has the benefits that multiple gel electrophoresis analysis is not required, the cost is reduced, the operation is simple and convenient, and detection results are accurate. The rapid detection kit and method for the legionella pneumophila ST1 strain is ideal.

Description

technical field [0001] The invention belongs to the field of microbial molecular detection, in particular to a rapid detection kit and method for Legionella pneumophila ST1 strain. Background technique [0002] Legionella is an intracellular gram-negative bacillus that is ubiquitous in soil and water systems. At present, there are 59 species of Legionella including more than 70 serotypes, and new strains are constantly isolated from the environment. In recent years, it has been found that about half of Legionella species are related to human diseases, and about 90% of Legionella infections are caused by Legionella pneumophila. [0003] Sequence typing of Legionella pneumophila (ST typing) is the SBT typing method of Legionella pneumophila established by the European Working Group on Legionella Infection (EWGLI). This method carries out PCR and sequencing fragments of seven genes flaA, pilE, asd, mip, mompS, proA and neuA of Legionella pneumophila, and compares the nucleoti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/686C12Q1/689C12Q2600/16C12Q2537/143C12Q2545/113Y02A50/30
Inventor 詹晓勇朱庆义胡朝晖
Owner GUANGZHOU KINGMED DIAGNOSTICS CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com