Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing fluorescent molecular weight interior label by means of site-specific mutagenesis and enzyme digestion techniques

A technology of molecular weight internal standard and site-directed mutagenesis, which is applied in the field of preparation of fluorescent molecular weight internal standard, can solve problems such as difficult large-scale production, difficult purification, misjudgment, etc.

Inactive Publication Date: 2017-06-20
THE FIRST RES INST OF MIN OF PUBLIC SECURITY +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method needs to explore the PCR amplification conditions, the amplified products tend to have non-specific bands, and the prepared molecular weight internal standard has poor stability
In the above method, since the length of the primer dimer is similar to the length of the small fragment in the internal standard, it is not easy to purify, so there are primer peaks mixed in, which is easy to cause misjudgment during data analysis, and is not easy to scale production
[0004] At present, there is no literature report on the method of preparing fluorescent molecular weight internal standard by using site-directed mutagenesis and enzyme digestion technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing fluorescent molecular weight interior label by means of site-specific mutagenesis and enzyme digestion techniques
  • Method for preparing fluorescent molecular weight interior label by means of site-specific mutagenesis and enzyme digestion techniques
  • Method for preparing fluorescent molecular weight interior label by means of site-specific mutagenesis and enzyme digestion techniques

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1) Design primers using the D2S441 locus of the human individual genome as a template

[0036] F: TTCAAGTCAGGGTTTCCAAG;

[0037] R: TTTTAGAGATAAGGTGTGCG;

[0038] Perform amplification, and clone the amplified fragment into T vector to obtain recombinant plasmid B.

[0039] 2) Select the 500bp sequence A of the D2S441 gene in the recombinant plasmid B

[0040] ATTTAACGTCTGCTGGTTTGTTATAAATAATGTTACAAAGGATAACAATGAAGAGATGGTCAGGCGAGGTATGGGGGAAGGGGCGTGGAGCTTCCATGTCCTCCCTGGGCGCCACCCTCCAGGAACCTCCACGTGTTCAGCTATACAGAAGCTTCCTGAACCCAGTCCTCTTGGGGTTTGAGGGAAGCTTCATGACATCAGCATTCCTTCCTCCAGGGTATTAATGGGACCCTCTCTGAAGAGATTCTTAAGACCCACGGCCAGAAAGTTGGGTAAAGACTAGAGTCCTGCCTTGGGGCAGGTGAAAGGAGTGCAAGAGAAGGTAAGAGAGATTCTGTTCCTGAGCCCTAATGCACCCAACATTCTAACAAAAGGCTGTAACAAGGGCTACAGGAATCATGAGCCAGGAACTGTGGCTCATCTATGAAAACTTCTATCTATCTATCTATCTATCTATCTATCTATCTAT

[0041] CTATCTATCTATATCATAACACCACAGCCAC

[0042] Perform site-directed cloning at the 50bp, 75bp, 100bp, 139bp, 150bp, 160bp, 200bp, 250bp, 300bp, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a fluorescent molecular weight interior label by means of site-specific mutagenesis and enzyme digestion techniques. The method comprises the steps of cloning a target DNA fragment A into a plasmid vector to obtain a recombinant plasmid B; conducting site-specific mutagenesis at different length positions of the DNA fragment A with the recombinant plasmid B as the template, and introducing a restriction enzyme cutting site to obtain a corresponding recombinant plasmid C; designing amplification primers F1 and R1 of the DNA fragment A, and conducting fluorescence labeling at the 5' end of each primer; amplifying the recombinant plasmid C by means of the amplification primers F1 and R1, so that an amplification product D is obtained, and purifying the product D; and conducting enzyme digestion on the purified amplification product D by means of restriction enzyme to obtain an enzyme digestion product E, namely the fluorescent molecular weight interior label. By the adoption of the method, molecular weight interior labels of 14 fragments from 50 bp to 500 bp can be prepared, the product does not have impure peaks such as primer peaks, and the process is suitable for large-scale production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for preparing a fluorescent molecular weight internal standard by using site-directed mutagenesis and enzyme cutting techniques. Background technique [0002] The molecular weight internal standard is a series of DNA fragments of different lengths that are electrophoresed in the same channel as the sample during STR detection. During data analysis, the size of the sample DNA can be calibrated by analyzing the relative peak positions of the sample DNA and the molecular weight internal standard. During electrophoresis, the peak time and peak shape of the molecular weight internal standard can also reflect the working status of the electrophoresis instrument. [0003] Chinese patent CN101050474 (disclosure date: 2007.10.10) discloses a method for preparing a molecular weight internal standard and the molecular weight internal standard prepared by this method, and CN 105296473A ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10
Inventor 荣海博管桦姜伯玮阮德林张涛金川王峰张黎明
Owner THE FIRST RES INST OF MIN OF PUBLIC SECURITY