A promoter optimization method based on ribosome binding site modification

A combination site and optimization method technology, applied in the fields of genetic engineering and microbial engineering, can solve problems such as increased difficulty in ribosome recognition, decreased protein expression levels, and decreased translation initiation efficiency

Active Publication Date: 2020-05-08
HUBEI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the secondary structure formed at the 5' end of mRNA will have an important impact on translation initiation. If the SD sequence and the initiation codon are located in a relatively stable hairpin structure, the difficulty of ribosome recognition will be greatly increased, resulting in translation initiation. The initial efficiency is reduced, and the protein expression level is reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A promoter optimization method based on ribosome binding site modification
  • A promoter optimization method based on ribosome binding site modification
  • A promoter optimization method based on ribosome binding site modification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] S1. According to the B. subtilis 168 genome sequence NZ_CP010052.1 released by the NCBI database, the original sequence of P43 was found. For the specific sequence, see the sequence listing SEQ ID NO: 1; Primer Primer 5 software was used to design primers P43-F and P43-SOE-R, The original promoter P43 was amplified using the total DNA of B. subtilis 168 as a template;

[0049] Primers were designed as follows:

[0050] P43-F: CGGAATTCTGATAGGTGGTATGTTTTCG

[0051] P43-SOE-R: CTTACCTATAATGGTACCAGATCTGCTATCACTTTAT

[0052] S2. Using the promoter P43 amplified in step S1 as a template, use the Primer Primer5 software to design primers P43-F and P43RBS1-SOE-R, and when designing the direction primer, subtract the 5 bases behind the primer P43RBS1-SOE-R and add the 5 bases of TTCAT in front of the primer P43RBS1-SOE-R, the promoter RBS1 is amplified by PCR, so that the sequence ATGAA is more behind the amplified sequence, and its specific sequence is shown in the sequence t...

Embodiment 2

[0058] S1. According to the B. subtilis 168 genome sequence NZ_CP010052.1 released by the NCBI database, the original sequence of P43 was found. For the specific sequence, see the sequence listing SEQ ID NO: 1; Primer Primer 5 software was used to design primers P43-F and P43-SOE-R, The original promoter P43 was amplified using the total DNA of B. subtilis 168 as a template;

[0059] Primers were designed as follows:

[0060] P43-F: CGGAATTCTGATAGGTGGTATGTTTTCG

[0061] P43-SOE-R:

[0062] CTTACCTATAATGGTACCAGATCTGCTATCACTTTAT;

[0063] S2. Using the promoter P43 amplified in step S1 as a template, use the Primer Primer5 software to design primers P43-F and P43RBS2-SOE-R, remove the two bases C and A from the P43 neck loop structure, and remove the RBS The binding region is changed from GTAAGAGAGG to GAAAGGAGG, and the promoter RBS2 is amplified by PCR, and its specific sequence is shown in SEQ ID NO:3 in the sequence table.

[0064] Primers were designed as follows:

[0...

Embodiment 3

[0069] S1. According to the B. subtilis 168 genome sequence NZ_CP010052.1 released by the NCBI database, the original sequence of P43 was found. For the specific sequence, see the sequence listing SEQ ID NO: 1; Primer Primer 5 software was used to design primers P43-F and P43-SOE-R, The original promoter P43 was amplified using the total DNA of B. subtilis 168 as a template;

[0070] Primers were designed as follows:

[0071] P43-F: CGGAATTCTGATAGGTGGTATGTTTTCG

[0072] P43-SOE-R:

[0073] CTTACCTATAATGGTACCAGATCTGCTATCACTTTAT;

[0074] S2. Using the promoter P43 amplified in step S1 as a template, use the Primer Primer5 software to design primers P43-F and P43RBS2-SOE-R, remove the two bases C and A from the P43 neck loop structure, and remove the RBS The binding region was changed from GTAAGAGAGG to GAAAGGAGG, and the promoter RBS2 was amplified by PCR;

[0075] Primers were designed as follows:

[0076] P43-F: CGGAATTCTGATAGGTGGTATGTTTTCG

[0077] P43RBS2-SOE-R:

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A ribosome binding site reconstruction-based promoter optimization method comprises the following steps: 1, amplifying the sequence of a ribosome binding site behind the transcription initiation site of a P43 promoter in Bacillus subtillis; and 2, amplifying a P43 promoter with the ribosome binding site sequence through primer design to obtain a sequence with at least one structure function. The ribosome binding site in the P43 promoter is optimized through the method to make the binding level of the optimized promoter and mRNA improved in order to improve the expression level of target gene.

Description

technical field [0001] The invention relates to the technical fields of genetic engineering and microbial engineering, in particular to a promoter optimization method based on modification of ribosome binding sites. Background technique [0002] The promoter is a DNA sequence located in the upstream region of the 5' end of the structural gene. It is a region on the DNA molecule that is recognized by RNA polymerase and transcription regulators and combines to form a transcription initiation complex. The conserved structural features of the promoter are: -10 region, -35 region, the distance between the two regions and the transcription start site TSS. Although the sequence between the two recognition regions is not conserved, the conservation of the distance between them is very important for the spatial geometric conformation of RNA polymerase binding. Previous studies have shown that the TATA region at position -10 and the TTGACA region at position -35 of the promoter are t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/75
CPCC07K14/32C12N15/75
Inventor陈守文彭炳何鹏辉蔡冬波陈耀中王勤魏雪团
OwnerHUBEI UNIV