GRNA (guide Ribonucleic Acid) sequence capable of effectively knocking out CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) of HTLV-1 (Human T-cell Leukemia Virus type 1) virus genome

A virus genome and sequence technology, applied in the field of gRNA sequences, can solve the problems of secondary infection, ineffective removal of HTLV-1, etc., and achieve the effect of inhibiting proliferation

Inactive Publication Date: 2017-07-18
HUAQIAO UNIVERSITY
View PDF1 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this series of treatment regimens cannot effectively eliminate HTLV-1, so HTLV-1 secondary infection is often caused after early treatment, which eventually leads to recurrence of lymphoma in patients in the short term, while the average Survival time also failed to exceed the limit of 18 months

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GRNA (guide Ribonucleic Acid) sequence capable of effectively knocking out CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) of HTLV-1 (Human T-cell Leukemia Virus type 1) virus genome
  • GRNA (guide Ribonucleic Acid) sequence capable of effectively knocking out CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) of HTLV-1 (Human T-cell Leukemia Virus type 1) virus genome
  • GRNA (guide Ribonucleic Acid) sequence capable of effectively knocking out CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) of HTLV-1 (Human T-cell Leukemia Virus type 1) virus genome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Recombinant plasmid primer design and target selection for constructing targeting sequence

[0027] Taking the LTR region of HTLV-1 as the target selection region, in this region, based on the basic principles of primer design, design several pairs of upstream and downstream primer sequences for different targets:

[0028] R1:

[0029] DNA forward sequence: CACCGGACTCAACCGGCGTGGATGG (SEQ ID NO 05, which is the first DNA forward sequence of the present invention, corresponds to the first RNA forward sequence, as shown in SEQ ID NO 01:

[0030] GACUCAACCGGCGUGGAUGG)

[0031] DNA reverse sequence: AAACCCATCCACGCCGGTTGAGTCC (SEQ ID NO 06, which is the first DNA reverse sequence of the present invention, corresponds to the first RNA reverse sequence, as shown in SEQ ID NO 02:

[0032] CCAUCCACGCCGGUUGAGUC)

[0033] R2:

[0034] DNA forward sequence: CACCGAGAACGCGACTCAACCGGCG (SEQ ID NO 07, which is the second DNA forward sequence of the present invention, corresponds to the se...

Embodiment 2

[0097] Example 2: Detection of various target indicators in cells

[0098] The plasmids constructed in Example 1 were packaged with viruses and infected cells, and the cells were tested for various target indicators

[0099] 1. Lentivirus packaging and stable strain screening

[0100] A. Lentivirus packaging

[0101] (1) Collect 293FT cells the day before transfection to 2×10 per plate 6 Cells (10mL cell suspension) were inoculated into a 10cm petri dish, 37℃, 5% CO 2 to cultivate. (293FT medium contains: DMEM, 10% FBS, P / S);

[0102] (2) After 12 hours, add 1mL OPTI-MEM to a 1.5mL EP tube, add 75μL Lipofectamine3000, and mix upside down; take another 1.5mLE tube and add 1mL OPTI-MEM and prepare the plasmid according to the following system: LentiCRISPRv2-gRNA (15μg ), pCMV-A8 / 9(15μg), pcDNA-VSVG(7.5μg)

[0103] (3) Mix upside down;

[0104] (4) Mix the above two mixtures together, let them stand at room temperature for 5 minutes, and drop them evenly on a 10 cm culture plate;

[0105] (...

Embodiment 3

[0237] Example 3 Animal experiment

[0238] The stable strain obtained in Example 2 was injected into mice to construct a mouse tumor model

[0239] (1) Collect cells and count them

[0240] (2) The left and right sides of each mouse's back were injected with the cells of the control group and the experimental group, the number was 7×10 5 Pcs / only

[0241] (3) After 4 weeks, the mice were dissected, tumors were removed, weighed, and various indicators of tumor cells were detected

[0242] The result is Figure 7 As shown in (A-C), both the tumor formation rate and the tumor volume of the experimental group were significantly lower than those of the control group; in addition, we tested the tumor-forming body of each group of mice through immunohistochemistry experimental technology, and the results are as follows Figure 7 As shown in (D), tumors appeared in the experimental group and cells in the control group not only formed larger tumors but also grew in good tumor cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gRNA (guide Ribonucleic Acid) target sequence capable of effectively knocking out CRISPR / Cas9 (Clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) of an HTLV-1 (Human T-cell Leukemia Virus type 1) virus genome and application of the gRNA target sequence. The gRNA target sequence comprises a first RNA forward sequence, a second RNA forward sequence, a first RNA reverse sequence and a second RNA reverse sequence, wherein the first RNA forward sequence and the first RNA reverse sequence are complementary with each other and comprise sequences shown as SEQ ID NO 01 and SEQ ID NO 02 respectively; the second RNA forward sequence and the second RNA reverse sequence are complementary with each other and comprise sequences shown as SEQ ID NO 03 and SEQ ID NO 04 respectively. The gRNA sequence disclosed by the invention can be used for effectively knocking out the HTLV-1 virus genome and can be used for effectively inhibiting proliferation of ATL (Adult T-cell Leukemia) cells and occurrence of tumors.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a CRISPR / Cas9 gRNA sequence that can effectively knock out the HTLV-1 virus genome. Background technique [0002] Adult T-cell leukemia (adult T-cell leukemia, ATL) is a malignant lymphoid system proliferative disease caused by human T cell lymphotropic virus type I (Human T cell lymphotropic virus, HTLV-1) infection. Currently, there is no treatment or prognosis for it The ideal plan seriously threatens human health. The high incidence of HTLV-1 infection in my country is concentrated in the coastal areas of Fujian and Taiwan. HTLV-1 is the first retrovirus found to be related to human diseases, with an incubation period of up to 40 years. When it infects host cells, it can randomly integrate its genome into host cell chromosomes. Existing treatment methods are very It is difficult to remove the latent virus in the host. [0003] About 20 million people in the world are infecte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85
Inventor许瑞安陈晨蔡坤郑廷金成文召
OwnerHUAQIAO UNIVERSITY