Method for preparing arabidopsis autophagy gene mutant and application of arabidopsis autophagy gene mutant

An autophagy gene and mutant technology, applied in the field of preparation of Arabidopsis autophagy gene mutants, can solve problems such as affecting grain quality

Active Publication Date: 2022-03-01
SOUTH CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, through the analysis of transgenic materials of rice OsATG8b overexpressed or knocked down, it was found that the autophagy pathway mediated by OsATG8b was involved in the nutrient cycle of nitrogen to the grain, and directly affected the quality of the grain
[0005] Due to the existence of multiple copies of the ATG8 family in plants, there has been a lack of direct genetic material to analyze the function of ATG8 in plant autophagy in detail, and there is no mutant plant model with full copy deletion of ATG8 for the study of the autophagy pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing arabidopsis autophagy gene mutant and application of arabidopsis autophagy gene mutant
  • Method for preparing arabidopsis autophagy gene mutant and application of arabidopsis autophagy gene mutant
  • Method for preparing arabidopsis autophagy gene mutant and application of arabidopsis autophagy gene mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 Creation of Arabidopsis nine-fold mutant atg8abcdefghi

[0041] according to figure 1 The technology roadmap shown in A shows that the Arabidopsis atg8abcdefghi nine-mutant homozygous line was constructed using CRISPR-Cas9 gene editing technology. Specific steps are as follows:

[0042] 1. Creation of atg8efg triple mutant

[0043] (1) Obtain the genome sequences of ATG8e (AT2G45170), ATG8f (AT4G16520), and ATG8g (AT3G60640) from the Arabidopsis TAIR database, and use the website http: / / skl.scau.edu.cn / according to the CDS sequence in the genome sequence Determine the CRISPR / Cas9 gene editing site (gene editing site such as figure 1 shown in B).

[0044] The ATG8e gene editing site is located in the third exon, and the sequence is GAAAAGAGAAAAGCTGAAGC (SEQ ID NO.1);

[0045] The ATG8f gene editing site is located in the second exon, and the sequence is GATCCAGGTGATTGTTGAGA (SEQ ID NO.2);

[0046] The ATG8g gene editing site is located in the fifth ex...

Embodiment 2

[0137] Example 2 Identification of ATG8 protein expression of Arabidopsis nine-fold mutant atg8abcdefghi by western blot hybridization

[0138] 1. Experimental method

[0139] (1) Protein extraction; wild-type Arabidopsis thaliana, autophagy mutant atg7-2 Arabidopsis (ABRC Arabidopsis Collection Center; article number: GABI_655B06), atg8hi mutant (using wild-type seeds as T0 seeds, using Agrobacterium, obtained by introducing pHEE401E-ATG8hi into wild-type seeds), the atg8efg homozygous triple mutant and atg8abcd mutant prepared in Example 1 (using wild-type seeds as T0 generation seeds, using Agrobacterium to introduce pHEE401E-ATG8abcd into wild type seeds), atg8efghi mutant (atg8efg is T0 generation seed, using Agrobacterium, pHEE401E-ATG8hi is introduced into atg8efg to obtain), atg8abcdefg homozygous seven mutants obtained in Example 1, atg8abcdefghi pure Seeds of Hejiu mutants were grown on Petri dishes for about 1 week. Weigh about 100 mg of the whole Arabidopsis seed...

Embodiment 3

[0144] Example 3 Phenotypic Analysis of Nitrogen Deficiency Stress in Arabidopsis atg8abcdefghi Homozygous Nine Mutants

[0145] 1. Experimental method

[0146] (1) The seeds of wild-type Arabidopsis thaliana, autophagy mutant atg7-2 and atg8abcdefghi homozygous nine mutants prepared in Example 1 were soaked and sterilized with 75% ethanol for 10 min respectively, and the sterilized seeds were sterilized at 4 ℃ refrigerator vernalization for 2 days.

[0147] (2) The vernalized seeds were sown on-demand in 1 / 2 MS solid medium containing 0.7% agarose, and placed in a light incubator at 22°C for germination and culture for 7 days.

[0148] (3) Prepare MS liquid medium (1L): weigh 4.3g MS solid medium (Sigma, M5519-1L), 0.4g of MES (Sangon Bioengineering (Shanghai) Co., Ltd., A100169), 10g of sucrose , with ddH 2 O was adjusted to 1 L, and finally the pH value was adjusted to 5.7 with 2 mM KOH.

[0149] Prepare MS-N liquid medium (1L): Measure 100mL of 10×MS-N solution (Sigma,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for preparing an arabidopsis thaliana autophagy gene mutant and application of the arabidopsis thaliana autophagy gene mutant, the method is characterized in that in wild type arabidopsis thaliana, copy genes of ATG8 genes are silenced by using a CRISPR / Cas9 system, and the copy genes are ATG8a, ATG8b, ATG8c, ATG8d, ATG8e, ATG8f, ATG8g, ATG8h and ATG8i. The introduction is to reduce cyclic utilization of plant nutrients. According to the invention, multiple mutants of all ATG8 genes can be accurately and effectively knocked out in a relatively short time through a CRISPR / Cas9 gene editing technology, and a solid foundation is laid for subsequent research on functions of ATG8 gene families. The invention also provides application of the ATG8 gene in reduction of plant nutrition cyclic utilization, provides a new gene resource for cultivation of new plant varieties with efficient nutrition utilization, and has important application value in agricultural production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for preparing an autophagy gene mutant of Arabidopsis thaliana. Background technique [0002] Autophagy is an important evolutionarily conserved metabolic pathway in which eukaryotes utilize lysosomes or vacuoles to degrade intracellular substances and organelles. This pathway mainly wraps the substrate to be degraded by a double-layer membrane structure to form an autophagosome. Substances are released into the vacuole and degraded by hydrolytic enzymes into recyclable small molecules. When eukaryotes face nutrient deficiency or insufficient material supply due to differentiation, cells will initiate autophagy to regulate the recycling of intracellular materials to ensure the normal operation of their various functions. Autophagy is indispensable for the normal growth of plants, and it is involved in almost all stages of plant growth and development, including seed germin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/29C12N15/55A01H5/10A01H5/00A01H6/20
CPCC12N15/8205C12N15/8218C12N15/8271C07K14/415C12N9/22
Inventor 黄晓刘易林谭慧琼李发强
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap