Kit for knocking out FUT8 (alpha-1,6-fucosyltrasnferase 8) and DHFR (dihydrofolate reductase) genes in Chinese hamster ovary cells
A kit and gene technology, applied in the field of genetic engineering, can solve the problems that have not been seen, and achieve the effects of simple and easy operation, good selection of engineered cell lines, and high amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Using the kit of the present invention to knock out the FUT8 and DHFR genes of CHO cells
[0059] 1. Knockout of the FUT8 gene in CHO-S cells
[0060] 1. Design sgRNA targeting FUT8 gene in CHO-S cells
[0061] According to the FUT8 gene sequence of CHO cells published by Genbank, sgRNA sequences targeting different exons (Exons) were designed. The designed sgRNA sequences are shown in Table 1:
[0062] Table 1 sgRNAs sequences
[0063] serial number sgRNA sequence (5‐‐‐3) direction PAM sequence sgRNA sequence position sgRNA2‐f (SEQ ID NO: 1) UGGGAUACCCACCACACUGC reverse AGG Exon8 sgRNA4‐f (SEQ ID NO: 2) ACAUGGACUCUGGGGAGAAG reverse TGG Exon9 sgRNA5‐f (SEQ ID NO: 3) GUCCAGCUUUGCAAGAAUCU reverse TGG Exon1
[0064] Genomic DNA was extracted from CHO-S cells, the genomic DNA was amplified using the primers in Table 2, the amplified product was recovered from the gel, connected to the precut pUCA (LUC)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



