Larimichthys crocea interferon regulatory factor IRF7 starter, nucleic acid builder, cell and preparing method and application of the larimichthys crocea interferon regulatory factor IRF7 starter

A technology of nucleic acid constructs and regulators, applied in the field of genetic engineering, can solve problems such as lack of research

Active Publication Date: 2017-08-18
JIMEI UNIV +1
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression levels of some fish interferon regulatory factor IRF7 genes in different tissues and the expression regulation under the stimulation of pathogens or pathogen-related analogues have been relatively clear. However, the expression regulation mechanism of fish interferon regulatory factor IRF7 genes is In particular, research on the regulatory network of cell signal transduction pathways involved in the interferon regulatory factor IRF7 is still relatively scarce

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Larimichthys crocea interferon regulatory factor IRF7 starter, nucleic acid builder, cell and preparing method and application of the larimichthys crocea interferon regulatory factor IRF7 starter
  • Larimichthys crocea interferon regulatory factor IRF7 starter, nucleic acid builder, cell and preparing method and application of the larimichthys crocea interferon regulatory factor IRF7 starter
  • Larimichthys crocea interferon regulatory factor IRF7 starter, nucleic acid builder, cell and preparing method and application of the larimichthys crocea interferon regulatory factor IRF7 starter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: the cloning of large yellow croaker interferon regulatory factor IRF7 gene promoter

[0037] Based on the following figure 1 process steps.

[0038] Using the large yellow croaker genome (extract the large yellow croaker genome DNA from the large yellow croaker on the market according to the normal genome extraction process) as a template, design primers, and the primer sequence is as follows;

[0039] Forward primer: 5′-CGG GGTACCGTCATCATCACATCAGGGGTCGG -3'SEQ ID NO:2; wherein the underlined straight line is the KpnI restriction site, and the underlined wavy line is SEQ ID NO:4;

[0040] Reverse primer: 5′-GA AGATCTCTGGCAAACTGAGGCTTGGGAGG -3' SEQ ID NO:3; where the underlined straight line is the Bgl II restriction site, and the underlined wavy line is SEQ ID NO:5.

[0041] Use TaKaRa ExTaq enzyme to PCR amplify the promoter of the large yellow croaker interferon regulatory factor IRF7 gene, and the PCR reaction system is as follows:

[0042]

...

Embodiment 2

[0048] Example 2: Construction of the large yellow croaker interferon regulatory factor IRF7 gene promoter recombinant vector pGL4-IRF7-pro

[0049] 1) Expand and cultivate the Top10 strain of the above-mentioned pMD19-T-IRF7-pro recombinant vector, extract the plasmid, and digest the recombinant plasmid with Kpn I / Bgl II, perform agarose gel electrophoresis, and cut the gel for recovery. Later IRF7 promoter;

[0050] 2) Digest the pGL4.17 luciferase reporter vector (promega company) with Kpn I / Bgl II double enzymes and recover the digested vector with a gel recovery kit;

[0051] 3) Use T4 DNA ligase from TaKaRa Company to connect the double-digested IRF7 promoter sequence fragment and the vector pGL4.17 to construct the recombinant vector pGL4-IRF7-pro. The connection system is as follows:

[0052]

[0053] Reaction conditions: Incubate overnight at 16°C;

[0054] 4) Transform the above ligation product into Escherichia coli Top10 competent cells, screen positive clones...

Embodiment 3

[0056] Example 3: Dual-luciferase reporter gene detection system analyzes the activity of the large yellow croaker interferon regulatory factor IRF7 gene promoter

[0057] 1. Inoculate EPC cells in a 24-well cell culture plate, 2×10 per well 5 Add 500 μl of MEM medium to each cell, and culture overnight in a biochemical incubator at 25°C;

[0058] 2. Use Invitrogen’s Lipofectamine for each well of EPC cells TM 3000 transfection reagent co-transfect 100ng of recombinant vector pGL4-IRF7-pro obtained in Example 2 and 10ng Renilla luciferase control reporter gene vector pRL-TK; at the same time, co-transfect 100ng empty vector pGL4.17 and 10ng sea Renal luciferase control The EPC cells of the reporter gene carrier pRL-TK were used as the control; 3 replicates were set for each treatment. The specific steps of cell transfection are as follows:

[0059] a) Mix the vector to be transfected (100ng pGL4-IRF7-pro+10ng pRL-TK or 100ng pGL4.17+10ng pRL-TK) with 25μl Opti-MEM medium (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a larimichthys crocea interferon regulatory factor IRF7 starter, a nucleic acid builder, a cell and a preparing method and application of the larimichthys crocea interferon regulatory factor IRF7 starter, the nucleic acid builder and the cell. The nucleotide sequence of the larimichthys crocea interferon regulatory factor IRF7 starter is shown as Seq ID No.1 or a nucleotide sequence complementary to Seq ID No.1. The invention further protects application of the starter or the nucleic acid builder or a carrier or a reconstitution cell or fish or a mammal containing the starter or the nucleic acid builder or the carrier or the reconstitution cell in regulating target gene expression or transgenic fish.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a large yellow croaker interferon regulatory factor IRF7 promoter, nucleic acid construct, cell and its preparation method and application. Background technique [0002] The Interferon regulatory factor (Interferon regulatory factor, IRF) family is an important class of transcription factors involved in the regulation of various biological functions such as the body's immune response, inflammatory response, and apoptosis, especially in the expression of interferon genes. important regulatory role (Taniquchi T, Oqasawara K, Takaoka A, et al., IRFfamily of transcription factors as regulators of host defense [J]. Annu Rev Immunol, 2001; 19:623–55). IRF7 is a member of the interferon regulatory factor family, and its protein molecular structure from the amino terminal to the carboxyl terminal is DNA binding domain (DNA binding domain, DBD), constitutive activation domain ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/10C12N15/85A01K67/027
CPCA01K67/0275A01K2227/10A01K2227/40C07K14/461C12N15/8509
Inventor邹鹏飞李莹姚翠鸾孙庆学张晴
OwnerJIMEI UNIV