Anguilla japonica transcription factor AP-1 gene promoter and application thereof

A technology of AP-1 and transcription factors, which is applied in the field of genetic engineering and can solve problems such as fish AP-1 gene promoters that have not been reported.

Active Publication Date: 2021-08-03
JIMEI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the function of c-Jun in mammals has been widely studied, but its reports in lower vertebrates are still very limited, although a few studies involving the cloning and analysis of c-Jun and c-Fos genes in teleosts It has been reported, but there is no report on the transcriptional regulation mechanism of fish AP-1 gene promoter (Xu, L., Y. Chen, Q. Li, T. He and X. Chen (2020). "999 -Molecular cloning and functional characterization of c-Jun in large yellow croaker (Larimichthys crocea). "Fish & Shellfish Immunology 98: 981-987.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anguilla japonica transcription factor AP-1 gene promoter and application thereof
  • Anguilla japonica transcription factor AP-1 gene promoter and application thereof
  • Anguilla japonica transcription factor AP-1 gene promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Cloning of the Japanese eel AP-1 gene promoter

[0043] 1. Using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 Kit to extract and purify the genomic DNA from the Japanese eel muscle tissue. The specific operation is as follows:

[0044] Take 10 mg of Japanese eel muscle tissue and mince it with a blade, put it in a 2 ml centrifuge tube, add 180 μL of Buffer GL, 20 μL of Proteinase K and 10 μL of RNase A (10 mg / mL), and warm it in a water bath at 56°C overnight for lysing .

[0045] Add 200 μL Buffer GB and 200 μL 100% ethanol to the lysate, and mix well by pipetting. Place the SpinColumn on the Collection Tube, transfer the solution to the Spin Column, centrifuge at 12,000 rpm for 2 minutes, and discard the filtrate.

[0046] Add 500 μL of Buffer WA to the Spin Column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate.

[0047] Add 700 μL of Buffer WB (with the specified volume of 100% ethanol previously added) to the SpinC...

Embodiment 2

[0055] Example 2 Analysis of the transcription factor binding site of the promoter sequence of the Japanese eel transcription factor AP-1 gene

[0056] On-line prediction software for transcription factor binding sites in 5′ flanking regions of genes registered online

[0057] Alibaba2 (http: / / gene-regulation.com / pub / programs / alibaba2 / index.html)

[0058] Copy the AP-1 gene promoter sequence that has been verified by the cloning test and paste it in the dialog box in fasta format, and click START to perform the prediction analysis of the transcription factor binding site. partial results such as figure 1 , figure 2 shown.

Embodiment 3

[0059] Example 3 Activity analysis of the promoter of the Japanese eel transcription factor AP-1 gene

[0060] 1. Construction of the recombinant luciferase reporter gene vector pGL3-AP1-pro containing the promoter fragment of the Japanese eel transcription factor AP-1 gene.

[0061] Insert the promoter fragment of the Japanese eel transcription factor AP-1 gene into the luciferase reporter gene vector pGL3-Basic of Promega Company, so that the expression of the firefly luciferase (Luciferase) reporter gene is controlled by the promoter of the Japanese eel AP-1 gene promoter , the luciferase recombinant vector constructed was named pGL3-AP1-pro. Specific steps are as follows:

[0062] Synthesize an upstream primer with a SmaI restriction site: 5 '- CCCGGGCATCGTTGTTCAC-3 ', and a downstream primer with a HindⅢ restriction site: 5 '- AAGCTTAGAAGAGTAACCAAAACTCAGTTC -3 '.

[0063]High-fidelity enzyme 2×PrimeSTAR® GC Buffer (Mg2+ plus) from Takara Company was used for amplificati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anguilla japonica transcription factor AP-1 gene promoter and an application thereof. The anguilla japonica transcription factor AP-1 gene promoter sequence is obtained by comparing and analyzing an anguilla japonica genome through a first exon sequence of an open reading frame of an anguilla japonica transcription factor AP-1 gene, and cloning an AP-1 gene 5'flanking region sequence analyzed and predicted by adopting a touchdown PCR method. Through detection, the promoter has relatively strong promoter activity. The anguilla japonica transcription factor AP-1 gene promoter can provide a good experimental system for researching an expression regulation mechanism of a fish transcription factor AP-1 gene and an important fish inflammation-related MAPK signal channel network regulation mechanism, and meanwhile, the promoter can be used for constructing an expression vector and then efficiently expressing an exogenous gene; or the promoter is applied to construction of a transgenic fish and has important theoretical and practical significance.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the Japanese eel transcription factor AP-1 promoter and its application. Background technique [0002] Activator protein-1 (activator protein-1, AP-1) is the most critical nuclear transcription factor for cell growth and differentiation. It is a homodimer or heterodimer composed of Jun, Fos, ATF and MAF protein families. Among them, the most important and typical AP-1 is a heterodimer composed of c-Jun and c-Fos subunits (Hess J, Angel P, Schorpp-Kistner M. AP-1 subunits: quarrel and harmony among siblings. J CellSci 2004; 117(Pt 25): 5965-73.). Mainly binds to DNA through its highly conserved basic leucine zipper (basicleucine zipper, bZIP), participates in the regulation of gene transcription of various growth factors and cytokines, in response to bacterial, viral infection, cytokines, growth factors and the environment The impact of various stimuli such as pressu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/12C12N15/70C12N15/74C12N15/75C12N15/81C12N15/85C12N1/21C12N1/19C12N5/10A01K67/027C12R1/19C12R1/125C12R1/01C12R1/645
CPCC12N15/113C07K14/47C12N15/70C12N15/74C12N15/75C12N15/81C12N15/85A01K67/0275A01K2227/40Y02A40/81
Inventor冯建军
OwnerJIMEI UNIV