Unlock instant, AI-driven research and patent intelligence for your innovation.

Double-marker probe real-time fluorescent PCR (polymerase chain reaction) method for quickly identifying Type IV FAV (fowl adenovirus) in serum

A kind of identification detection, real-time fluorescence technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of complicated operation, inaccurate quantification, pollution of the environment, etc., to avoid false negative/positive situation, shorten the detection Good time and repeatability

Active Publication Date: 2017-09-12
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The entire experimental process of this technology is carried out in a completely closed tube state, without the need for PCR post-processing and tedious electrophoresis, ultraviolet or staining detection, which solves the problems of inaccurate quantification, complicated operation, and environmental pollution in conventional PCR experiments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-marker probe real-time fluorescent PCR (polymerase chain reaction) method for quickly identifying Type IV FAV (fowl adenovirus) in serum
  • Double-marker probe real-time fluorescent PCR (polymerase chain reaction) method for quickly identifying Type IV FAV (fowl adenovirus) in serum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1. Primer Design

[0025] Referring to the genome sequence of FAV in GenBank, a pair of primers (FAV-FQ-F, FAV-FQ-R) and probe P were designed, and the fluorescent markers were FAM and Eclipse; the primers were synthesized by Dalian TaKaRa Company and purified at HPLC level; The primer and probe sequences are as follows:

[0026] FAV-FQ-F: 5'-CTAGGGTTCTGAACTTTG-3' (48-65),

[0027] FAV-FQ-R: 5'-CGGTAAACATTTCAAGGA-3' (190-173), the amplified length is 143bp;

[0028] Probe P: 5'-(FAM)TGACGCCAGTTTCGCTTTCG (Eclipse)-3'(72-91).

[0029] 2. Real-time PCR

[0030] 2.1 Extraction of DNA

[0031] Broiler FAV isolated strains GF16 and WF816 were selected for detection. Virus DNA was extracted according to the operation of TaKaRa DNAiso reagent, and finally 30 μL of ultrapure water was used to dissolve the DNA; the specific operation was as follows:

[0032] Inoculate the yolk sac of 6-day-old SPF chicken embryos with the virus to be tested, collect the allantoic fluid and e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a double-marker probe real-time fluorescent PCR (polymerase chain reaction) method for quickly identifying Type IV FAC (fowl adenovirus) in serum. The method comprises the following steps of firstly, according to a sequence of a fowl adenovirus genome, designing a pair of primers FAV-FQ-F and FAV-FQ-R and a probe P; then, extracting DNA (deoxyribonucleic acid) of the FAV virus, and dissolving by pure water; finally, using the designed primers and probe to perform real-time fluorescent PCR detection. The method has the advantages that the Type IV FAV in serum can be quickly, sensitively and accurately detected, the detection time is greatly shortened, and the other epidemic main serum types in the corresponding period can be distinguished; the false negative / positive condition of the common PCR is avoided, the rapidity, accuracy, sensitivity and good repeatability are realized, and the method can be applied to laboratory detection of FAV samples.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a detection method for avian adenovirus, in particular to a double-labeled probe real-time fluorescent PCR method for rapidly identifying and detecting serum type 4 avian adenovirus. Background technique [0002] Fowl adenovirus (FAV) can be divided into 3 groups according to antigenic differences, among which group I is traditional adenovirus, including 12 serotypes (FAV1-12) isolated from chickens, 2 serotypes from turkey serotypes, goose 3 serotypes and duck 2 serotypes. Avian adenovirus can cause inclusion body hepatitis, pericardial effusion, gizzard erosion and other lesions. Since June 2015, an infectious disease characterized by rapid death, high mortality, and pericardial effusion as the main lesion has broken out in broilers in some areas of Shandong Province. The infection speed of the disease is very fast, and the infected hosts have also expanded to breeds such as laying...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/686C12Q1/701C12Q2563/107C12Q2561/113
Inventor 袁小远王友令于可响艾武亓丽红
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI