Double-marker probe real-time fluorescent PCR (polymerase chain reaction) method for quickly identifying Type IV FAV (fowl adenovirus) in serum
A kind of identification detection, real-time fluorescence technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of complicated operation, inaccurate quantification, pollution of the environment, etc., to avoid false negative/positive situation, shorten the detection Good time and repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1. Primer Design
[0025] Referring to the genome sequence of FAV in GenBank, a pair of primers (FAV-FQ-F, FAV-FQ-R) and probe P were designed, and the fluorescent markers were FAM and Eclipse; the primers were synthesized by Dalian TaKaRa Company and purified at HPLC level; The primer and probe sequences are as follows:
[0026] FAV-FQ-F: 5'-CTAGGGTTCTGAACTTTG-3' (48-65),
[0027] FAV-FQ-R: 5'-CGGTAAACATTTCAAGGA-3' (190-173), the amplified length is 143bp;
[0028] Probe P: 5'-(FAM)TGACGCCAGTTTCGCTTTCG (Eclipse)-3'(72-91).
[0029] 2. Real-time PCR
[0030] 2.1 Extraction of DNA
[0031] Broiler FAV isolated strains GF16 and WF816 were selected for detection. Virus DNA was extracted according to the operation of TaKaRa DNAiso reagent, and finally 30 μL of ultrapure water was used to dissolve the DNA; the specific operation was as follows:
[0032] Inoculate the yolk sac of 6-day-old SPF chicken embryos with the virus to be tested, collect the allantoic fluid and e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

