A primer composition and kit for detecting calr gene type 1 mutation

A primer composition and kit technology, applied in the field of molecular biology, can solve the problems of time-consuming and labor-intensive, long reporting period, and high technical platform requirements, and achieve low equipment and environmental requirements, fast detection speed, and high detection sensitivity. Effect

Active Publication Date: 2020-08-25
AFFILIATED HUSN HOSPITAL OF FUDAN UNIV +2
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the detection of CALR gene mutation mainly relies on probe real-time PCR method or sequencing method, etc. The above methods are time-consuming and labor-intensive, have a long reporting cycle, and have defects in sensitivity. The detection equipment required is expensive, and special equipment must be used for detection Equipment and well-trained technicians have high requirements on the technology platform and are not easy to be widely promoted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer composition and kit for detecting calr gene type 1 mutation
  • A primer composition and kit for detecting calr gene type 1 mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] This example is the target sequence of the CALR gene type 1 mutation selected in the present invention, as well as the primer and probe sequences for detecting the CALR gene type 1 mutation.

[0028] Select the target fragment to be detected around the position of the CALR gene type 1 mutation, and use the online LAMP primer design website PrimerExplorer V5 (https: / / primerexplorer.jp / lampv5 / index.html) to design appropriate specific primers for the target fragment ,

[0029] (1) The primer sequence is:

[0030] F3: TGCAGGCAGCAGAGAA (SEQ ID NO: 2);

[0031] B3: TTTGGCGCGGCCAGCT (SEQ ID NO: 3);

[0032] FIP: TCTTTGTCCTCATCATCCTCCTTGACAAATGAAGGACAAACAGG (SEQ ID NO: 4)

[0033] BIP: AGATGTCCCCGGCCAGGCAGGCCTCAGTCCAGC (SEQ ID NO: 5);

[0034] LF: TCCTCTGCTCCTCGT (SEQ ID NO: 6);

[0035] LB: GCTGTAGAGAGGCCTGCCTCCAG (SEQ ID NO: 7).

[0036] (2) The sequence of peptide nucleic acid blocking probe PNA is:

[0037] CTTAAGGAGGAGGAAG-KK (SEQ ID NO: 8) (16nt, 2 lysines were ad...

Embodiment 2

[0041] This embodiment is the kit and method for detecting CALR gene type 1 mutation of the present invention.

[0042] The kit used in the present invention includes an amplification reaction system, the total volume of which is 25 μL, which includes 12.5 μL of 2× reaction buffer (RM), primer F3: 1 μL (final concentration 0.2 μmol / L), Primer B3: 1 μL (final concentration 0.2 μmol / L), primer FIP: 1 μL (final concentration 1.6 μmol / L), primer BIP: 1 μL (final concentration 1.6 μmol / L), primer LF: 1 μL (final concentration 0.8 μmol / L ), primer LB: 1 μL (final concentration 0.8 μmol / L), PNA probe: 1 μL (final concentration 0.8 μmol / L), Bst DNA polymerase 1 μL (8U), calcein (FD) 1 μL, deionized water 1.5 μL , DNA template 2 μL.

[0043]The above kit is used for LAMP reaction, the LAMP reaction conditions are: 58°C-68°C, 60min; the equipment used is an ordinary PCR instrument or a constant temperature metal bath that can stably provide a constant temperature of 65°C; and then perf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a primer composition for detecting mutation of a CALR gene type 1. The primer composition comprises primers containing sequences as shown in SEQ ID NO:2-SEQ ID NO: 7 and a PNA probe containing a sequence as shown in a SEQ ID NO: 8. The invention also relates to a kit containing the primer composition and a detection method thereof as well as a target sequence of mutation of the CALR gene type 1 amplified by the primer composition. The target sequence is a sequence as shown in a SEQ ID NO: 1. The kit and detection method provided by the invention have good specificity and stability. A sample with gradient mutational load concentrations is amplified by means of an established LAMP reaction system, the mutational load detection sensitivity can reach 1% which is equivalent to the effect of probe method real-time PCR, and the mutation of the CALR gene type 1 can be visually detected thereby. Compared with a conventional detection method, the method is low in demand on equipment and environment, higher in detection speed and higher in detection sensitivity.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a primer composition and a kit for detecting CALR gene type 1 mutation. Background technique [0002] Myeloproliferative neoplasms (MPNs) are clonal hematopoietic stem / progenitor cell disorders characterized by proliferation of one or more myeloid cells in the bone marrow and increased mature and immature cells in the peripheral blood. In recent years, multiple molecular markers, such as JAK2, MPL, and TET mutations, have been discovered one after another. The discovery of these markers is of great significance for understanding the molecular pathogenesis of MPN, and is also helpful for the diagnosis and treatment of patients with this disease . However, 30% to 45% of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF) carrying wild-type JAK2 / MPL are still difficult to diagnose. The newly reported calreticulin gene ( CALR) mutation will partially fill th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6844C12Q1/6886C12Q2600/156C12Q2531/119
Inventor 关明曹国君方雪恩唐宜桂许笑孔继烈张心菊李杨
Owner AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap