Unlock instant, AI-driven research and patent intelligence for your innovation.

Functional molecular markers and their applications for screening maize late flowering traits under long-day conditions

A molecular marker and functional technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of inability to predict maize germplasm resources, inability to directly apply, inability to estimate the interval period, etc.

Active Publication Date: 2020-08-25
JILIN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problem that the breeders in the main producing areas of spring maize cannot predict whether the obtained maize germplasm resources can be planted in the temperate long-sunshine area before planting can flower normally, and it is impossible to estimate the appropriate interval for the staggered flowering period in hybridization and backcross breeding. Technical problem, to overcome the shortcoming that the late flowering of tropical ancestral maize materials cannot be directly applied to the production of temperate maize materials, the present invention provides a functional molecular marker for screening late flowering traits of maize under long-day conditions and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Functional molecular markers and their applications for screening maize late flowering traits under long-day conditions
  • Functional molecular markers and their applications for screening maize late flowering traits under long-day conditions
  • Functional molecular markers and their applications for screening maize late flowering traits under long-day conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Obtaining the specific differential sequence of the ZmCOL3 promoter of the maize flowering regulation gene

[0031] 1. Experimental materials

[0032] Normal flowering maize inbred line under long-day conditions: B73;

[0033] Late-flowering maize inbred line under long-day conditions: CML432.

[0034] 2. Genomic DNA extraction

[0035] Maize leaves were collected at the seedling stage, and genomic DNA was extracted from normal flowering maize inbred line B73 and late flowering maize inbred line CML432 by CTAB method.

[0036]The specific steps are as follows: under the condition of liquid nitrogen, quickly grind about 0.5-1 g of corn leaf into powder, transfer it to a 2ml centrifuge tube, add about 800 μL of CTAB buffer solution preheated at 65°C, and mix well; put the centrifuge tube in Place in a water bath at 65°C for 15 minutes, then take it out and add 10 μL of RNAase (RNase, the concentration is 10 mg / ml), continue the water bath for 1 to 1.5 hours, ...

Embodiment 2

[0053] Example 2 Development of a functional molecular marker InDel-PZmCOL3 for screening maize late flowering traits under long-day conditions and its genotype analysis on tropical and temperate kinship maize

[0054] 1. Design primers

[0055] The sequences on both sides of the deletion in the ZmCOL3 gene of the normal flowering maize inbred line B73 were selected, and the primers were designed using the software Primer5. Synthesized by Industrial Bioengineering (Shanghai) Co., Ltd., using sterilized ddH 2 O was diluted to 10 μmol / L, and stored at -20°C for later use.

[0056] The primer sequences are as follows:

[0057] Forward primer (INDEL-F): 5'-AGCCTAAGCATCTCCAAGGG-3' (SEQ ID NO: 3),

[0058] Reverse primer (INDEL-R): 5'-CGGGTTTGCTCCTTTGTTCG-3' (SEQ ID NO: 4).

[0059] 2. Investigation of experimental materials and flowering period

[0060] 317 association analysis genetic populations were used for genotyping and flowering phenotype testing.

[0061] It was found...

Embodiment 3

[0065] Example 3 Using the functional molecular marker InDel-PZmCOL3 to perform genotype analysis and flowering period traits association analysis on the F2 generation population

[0066] In order to further clarify whether the P-217-type and A-551-type are closely linked to the maize flowering period in the genetic population, the tropical ancestry maize material CML189 (P-217-type) and the temperate ancestry maize material Mo17 (A-551- type) were crossed, and the F2 generation genetic population was constructed; they were planted in three different ecological regions of Hubei, Hainan and Jilin, and the flowering-related traits such as tasseling, silking and loose powder were investigated.

[0067] The genotypes of more than 1000 individual plants of the F2 generation genetic population were analyzed by using the functional molecular marker InDel-PZmCOL3. The study found that the genetic segregation ratio of homozygous P-217-type, heterozygous A-551 / P-217-type and homozygous ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A functional molecular marker for screening late flowering traits of maize under long-day conditions and its application relate to the field of biology. The functional molecular marker InDel‑PZmCOL3 used to screen maize late flowering traits under long-day conditions, its PCR primer sequence is: forward primer: 5′‑AGCCTAAGCATCTCCAAGGG‑3′, reverse primer: 5′‑CGGGTTTGCTCCTTTGTTCG‑3′. The present invention designs specific functional molecular markers based on the above-mentioned specific difference sequences, which is beneficial to the genetic breeding of tropical ancestral maize materials into temperate maize production areas, and not only retains the excellent disease resistance alleles introduced into tropical ancestry maize materials, but also improves The late flowering of tropical maize materials cannot be directly applied to the production of temperate maize materials.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a functional molecular marker for screening late flowering traits of maize under long-day conditions and an application thereof. Background technique [0002] Functional markers are developed based on polymorphic motifs within functional genes that cause variation in phenotypic traits. Once genetic effects are mapped to specific functional motifs, functional signatures developed based on this association can be used to identify the presence or absence of the target allele in different genetic backgrounds without further validation. In terms of application, functional markers can avoid selection errors caused by recombination and exchange, and are more effective in the detection of target genes in groups; because they come from within genes, they directly reflect the performance of target traits, and can accurately detect and track target genes, and Its genetic effect value is univer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 刘相国金敏亮严建兵郝东云贾伟尹悦佳刘洋
Owner JILIN ACAD OF AGRI SCI