Method for constructing Glrx1 gene knock-out animal model based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technology
A technology for gene knockout and construction method, which can be used in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc., and can solve problems such as low success rate and unapplied application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The construction method of the Glrx1 gene knockout animal model based on CRISPR / Cas9 technology is realized through the following steps:
[0032] Step 1: Selection and design of gRNA targeting mouse Glrx1 gene
[0033] Design Glrx-1-Cas9-KO mouse strategies such as figure 1 shown. According to the strategy, design the corresponding sgRNA sequence, according to the strategy, design the corresponding sgRNA at the corresponding position of the Glrx-1 intron, and order the corresponding Oligo; the sgRNA sequence is as follows:
[0034] sgRNA name
sequence
PAM
Glrx-3S1 (forward)
CGGAGATGACACTTACTGATGGG (SEQ ID NO. 1)
GGG
Glrx-5S1 (forward)
GCTAAGCGCCGCTGCATTACCGG (SEQ ID NO. 2)
CGG
[0035] Step 2: sgRNA vector construction
[0036] Firstly, the pUC57-sgRNA carrier was digested with BsaI, and after 1 hour in a water bath at 37° C., electrophoresed on 1% agarose to recover the digested product. The ordered sgRNA primers ...
Embodiment 2
[0061] The difference between this example and Example 1 is that the single-stranded DNA template and primer sequence used in Step 3 are 2074-Glrx-gtF1. Other steps are identical with embodiment 1; Results are all identical with embodiment 1.
Embodiment 3
[0063] The difference between this example and Example 1 is that in step 4, the breed of caged male mice is preferably C57BL / 6J male mice. Other steps are the same as in Example 1.
[0064] Nanjing Agricultural University
[0065] A method for constructing a Glrx1 gene knockout animal model based on CRISPR / Cas9 technology
[0066] 2
[0067] 1
[0068] 23
[0069] DNA
[0070] Artificial sequence
[0071]
[0072] Primer Glrx-3S1
[0073] 1
[0074] cggagatgac acttactgat ggg 23
[0075] 2
[0076] 23
[0077] DNA
[0078] Artificial sequence
[0079]
[0080] Primer Glrx-5S1
[0081] 2
[0082] gctaagcgcc gctgcattac cgg 23
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap