Method for constructing Glrx1 gene knock-out animal model based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technology

A technology for gene knockout and construction method, which can be used in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc., and can solve problems such as low success rate and unapplied application.

Active Publication Date: 2017-10-24
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 56 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional gene knockout method has a very low success rate and has not been applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing Glrx1 gene knock-out animal model based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technology
  • Method for constructing Glrx1 gene knock-out animal model based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technology
  • Method for constructing Glrx1 gene knock-out animal model based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The construction method of the Glrx1 gene knockout animal model based on CRISPR / Cas9 technology is realized through the following steps:

[0032] Step 1: Selection and design of gRNA targeting mouse Glrx1 gene

[0033] Design Glrx-1-Cas9-KO mouse strategies such as figure 1 shown. According to the strategy, design the corresponding sgRNA sequence, according to the strategy, design the corresponding sgRNA at the corresponding position of the Glrx-1 intron, and order the corresponding Oligo; the sgRNA sequence is as follows:

[0034] sgRNA name

sequence

PAM

Glrx-3S1 (forward)

CGGAGATGACACTTACTGATGGG (SEQ ID NO. 1)

GGG

Glrx-5S1 (forward)

GCTAAGCGCCGCTGCATTACCGG (SEQ ID NO. 2)

CGG

[0035] Step 2: sgRNA vector construction

[0036] Firstly, the pUC57-sgRNA carrier was digested with BsaI, and after 1 hour in a water bath at 37° C., electrophoresed on 1% agarose to recover the digested product. The ordered sgRNA primers ...

Embodiment 2

[0061] The difference between this example and Example 1 is that the single-stranded DNA template and primer sequence used in Step 3 are 2074-Glrx-gtF1. Other steps are identical with embodiment 1; Results are all identical with embodiment 1.

Embodiment 3

[0063] The difference between this example and Example 1 is that in step 4, the breed of caged male mice is preferably C57BL / 6J male mice. Other steps are the same as in Example 1.

[0064] Nanjing Agricultural University

[0065] A method for constructing a Glrx1 gene knockout animal model based on CRISPR / Cas9 technology

[0066] 2

[0067] 1

[0068] 23

[0069] DNA

[0070] Artificial sequence

[0071]

[0072] Primer Glrx-3S1

[0073] 1

[0074] cggagatgac acttactgat ggg 23

[0075] 2

[0076] 23

[0077] DNA

[0078] Artificial sequence

[0079]

[0080] Primer Glrx-5S1

[0081] 2

[0082] gctaagcgcc gctgcattac cgg 23

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a Glrx1 gene knock-out animal model based on a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 technology. The method comprises the following steps: 1, selecting and designing gRNA of Glrx1 genes of targeted mice; 2, constructing an sgRNA vector; 3, performing in vitro transcription on sgRNA; 4, injecting one cell stage fertilized eggs of mice; 5, birth and identification of F0-generation mice; and 6, reproducing positive F0-generation mice, and realizing birth and identification of F1-generation mice. According to the method disclosed by the invention, the Glrx1 gene knock-out animal model can be successfully obtained.

Description

technical field [0001] The invention belongs to the field of making a gene knockout animal model by using gene modification technology, and in particular relates to a method for constructing a Glrx1 gene knockout animal model based on CRISPR / Cas9 technology. Background technique [0002] The CRISPR / Cas (Clustered Regularly Interspaced Shot Palindromic repeats / CRISPR-associated) system is a technique for targeted modification of target genes by RNA-mediated Cas proteins derived from bacterial acquired immunity. The Type II CRISPR / Cas9 system modified by researchers has been applied to gene knockout in various model organisms since it successfully knocked out mammalian cells in 2013. The construction of CRISPR / Cas9 system vector is simple, fast, easy to operate, time-saving and labor-saving, and the cycle is short, and it is applicable to almost all species. Both CRISPR / Cas9 and TALEN (Transcription Activator-like Effector Nucleases) function to achieve double-strand breaks a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027
CPCA01K67/0275C12N9/22C12N15/902A01K2267/03A01K2227/105C12N9/0051C12Y108/01008C12N2310/20C12N15/1137C12N15/907A01K67/0276
Inventor李春保邹小雨周光宏石学彬徐幸莲
OwnerNANJING AGRICULTURAL UNIVERSITY