Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primers and probe for detecting peste des petits ruminants virus and kit

A technology of Peste des petits ruminants and probes, applied in the field of molecular biology, can solve the problems of low detection sensitivity and high false positives, and achieve the effects of improving positive rate, accurate identification and good specificity

Inactive Publication Date: 2012-09-19
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods can be used for the detection of small ruminant virus, but there are shortcomings such as low detection sensitivity and high false positive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and probe for detecting peste des petits ruminants virus and kit
  • Primers and probe for detecting peste des petits ruminants virus and kit
  • Primers and probe for detecting peste des petits ruminants virus and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Design and synthesis of primers and probes used in real-time fluorescent quantitative PCR detection method for Peste des petits ruminants virus

[0040]According to the gene sequence of Peste des petits ruminants virus published by GenBank, the highly conserved N gene was selected as the amplification region by sequence comparison, and a pair of specific primers and a probe were designed. The primers and probe were synthesized by Bao Bioengineering (Dalian) Co., Ltd. , PCR amplification product is 60bp.

[0041] The above primer sequences are:

[0042] Upstream primer F: 5'-TCCATCATTACCCGTTCAAGACT-3' (SEQ ID NO.2),

[0043] Downstream primer R: 5'-GTCAGGATCTCCGGCCAAT-3' (SEQ ID NO.3).

[0044] The probe sequence is:

[0045] (FAM)5'-CTCGACAGGCTTGTCA-3'(TAMRA) (SEQ ID NO. 4).

[0046] The amplified target gene sequence is:

[0047] TCCATCATTACCCGTTCAAGACTGCTCGACAGGCTTGTCAGATTGGCCGGAGATCCTGAC (SEQ ID NO. 1).

[0048] The nucleotide sequence shown in SEQ ID...

Embodiment 2

[0050] Example 2 Establishment of Real-time Fluorescent Quantitative PCR Detection Method for Peste des Petits Ruminants Virus

[0051] 1. Experimental materials

[0052] 1.1 Virus species, strains and vectors

[0053] Peste des petits ruminants virus (PPRV) N75 / 1 strain (purchased from the China Veterinary Drug Administration), measles virus (MV), and canine distemper virus (CDV) are preserved in this laboratory; DH5α competent cells are preserved in this laboratory; 2.1-T cloning kit was purchased from Invitrogen.

[0054] 1.2 Main instruments and reagents

[0055] iQ5 fluorescent quantitative PCR instrument was purchased from Bio-Rad; From Tiangen Biochemical Technology (Beijing) Co., Ltd.; reverse transcriptase (AMV, 200U / μL) was purchased from Promega Company.

[0056] 1.3 Primers and probes

[0057] Refer to Example 1 for the nucleotide sequences of the upstream primer F, the downstream primer R and the probe.

[0058] 2. Methods and results

[0059] 2.1 Preparat...

Embodiment 3

[0083] Sensitivity, specificity and detection limit evaluation of embodiment 3PPRV fluorescent PCR detection system

[0084] 1. Sensitivity evaluation

[0085] Sensitivity, also known as true positive rate, is actually the percentage that is correctly judged as Peste des petits ruminants according to the standard of the detection method of the present invention. The fluorescent quantitative PCR detection system of Peste des petits ruminants virus established in the present invention and the common reverse transcription PCR method were used to simultaneously detect 105 clinically isolated disease materials suspected of Peste des petits ruminants. As shown in Table 1, the method established by the present invention has a sensitivity of 98.9% (92 / 93) compared with ordinary RT-PCR (that is, the probe of the present invention is not added, and the primers used are the same as the method of the present invention).

[0086] Table 1 Evaluation of the detection results of fluorescent ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker, real-time fluorescence quantitative PCR (polymerase chain reaction) primers and a probe used for detecting peste des petits ruminants through the N gene sequencing and comparison of the peste des petits ruminants, and the nucleotide sequences of the genetic marker, the primers and the probe are respectively disclosed in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention also provides a quantitive detection method and a detection kit for the peste des petits ruminants virus. The detection method and the detection kit disclosed by the invention have the advantages of accuracy in detection, high flexibility, strong specificity, easiness and rapidness, and the specimen detection capacity is good.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a target sequence for detecting PPR, a fluorescent quantitative PCR primer and a probe, and also relates to a method and a kit for detecting PPR using the target sequence. Background technique [0002] Peste des petits ruminants (PPR) is an acute, severe, contagious disease caused by Peste des petits ruminants virus (PPRV). Because of its high morbidity and mortality, It poses a great threat to animals such as goats, sheep, white-tailed deer, wild gazelles and Tibetan antelopes. It is a severe infectious disease recognized worldwide, and my country has also listed the disease as a first-class animal infectious disease. After Peste des Petits Ruminants was first reported in Côte d'Ivoire in West Africa in 1942, most African countries have successively reported the occurrence of the disease. In recent years, Peste des petits ruminants has been spreading further. In 2007, it was fi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 史利军金红岩王勇程超飞黄华欣李刚朱鸿飞
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More