Primers and probe for detecting peste des petits ruminants virus and kit
A technology of Peste des petits ruminants and probes, applied in the field of molecular biology, can solve the problems of low detection sensitivity and high false positives, and achieve the effects of improving positive rate, accurate identification and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Design and synthesis of primers and probes used in real-time fluorescent quantitative PCR detection method for Peste des petits ruminants virus
[0040]According to the gene sequence of Peste des petits ruminants virus published by GenBank, the highly conserved N gene was selected as the amplification region by sequence comparison, and a pair of specific primers and a probe were designed. The primers and probe were synthesized by Bao Bioengineering (Dalian) Co., Ltd. , PCR amplification product is 60bp.
[0041] The above primer sequences are:
[0042] Upstream primer F: 5'-TCCATCATTACCCGTTCAAGACT-3' (SEQ ID NO.2),
[0043] Downstream primer R: 5'-GTCAGGATCTCCGGCCAAT-3' (SEQ ID NO.3).
[0044] The probe sequence is:
[0045] (FAM)5'-CTCGACAGGCTTGTCA-3'(TAMRA) (SEQ ID NO. 4).
[0046] The amplified target gene sequence is:
[0047] TCCATCATTACCCGTTCAAGACTGCTCGACAGGCTTGTCAGATTGGCCGGAGATCCTGAC (SEQ ID NO. 1).
[0048] The nucleotide sequence shown in SEQ ID...
Embodiment 2
[0050] Example 2 Establishment of Real-time Fluorescent Quantitative PCR Detection Method for Peste des Petits Ruminants Virus
[0051] 1. Experimental materials
[0052] 1.1 Virus species, strains and vectors
[0053] Peste des petits ruminants virus (PPRV) N75 / 1 strain (purchased from the China Veterinary Drug Administration), measles virus (MV), and canine distemper virus (CDV) are preserved in this laboratory; DH5α competent cells are preserved in this laboratory; 2.1-T cloning kit was purchased from Invitrogen.
[0054] 1.2 Main instruments and reagents
[0055] iQ5 fluorescent quantitative PCR instrument was purchased from Bio-Rad; From Tiangen Biochemical Technology (Beijing) Co., Ltd.; reverse transcriptase (AMV, 200U / μL) was purchased from Promega Company.
[0056] 1.3 Primers and probes
[0057] Refer to Example 1 for the nucleotide sequences of the upstream primer F, the downstream primer R and the probe.
[0058] 2. Methods and results
[0059] 2.1 Preparat...
Embodiment 3
[0083] Sensitivity, specificity and detection limit evaluation of embodiment 3PPRV fluorescent PCR detection system
[0084] 1. Sensitivity evaluation
[0085] Sensitivity, also known as true positive rate, is actually the percentage that is correctly judged as Peste des petits ruminants according to the standard of the detection method of the present invention. The fluorescent quantitative PCR detection system of Peste des petits ruminants virus established in the present invention and the common reverse transcription PCR method were used to simultaneously detect 105 clinically isolated disease materials suspected of Peste des petits ruminants. As shown in Table 1, the method established by the present invention has a sensitivity of 98.9% (92 / 93) compared with ordinary RT-PCR (that is, the probe of the present invention is not added, and the primers used are the same as the method of the present invention).
[0086] Table 1 Evaluation of the detection results of fluorescent ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 