Human keratin KRT80 gene and application

A gene and gene expression technology, which is applied to the human keratin gene KRT80 and its expression and application in lung cancer, can solve the problems of protein expression, role and mechanism that have not yet been reported.

Inactive Publication Date: 2017-11-10
信雅生物科技(苏州)有限公司
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is a pity that there are no reports on the related functions of the KRT80 gene, and there are no reports on its protein expression and its role and mechanism in tumors and other diseases.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human keratin KRT80 gene and application
  • Human keratin KRT80 gene and application
  • Human keratin KRT80 gene and application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 2

[0039] The development of siRNA capable of specifically inhibiting the KRT80 gene comprises the following steps:

[0040] (1) Use NCBl (https: / / www.ncbi.nlm.nih.gov / gene) database to obtain information on the transcript coding (CDS) region (99-1457bp) of the human KRT80 gene, (NM_182507.2) CDS region The specific sequence is as follows.

[0041] NM_182507.2:atggcctgccgctcctgcgtggttggcttcagcagcctcagcagctgtgaggtgaccccggtgggcagcccccggcctggaacctcaggatgggacagctgcagggcccccgggccgggcttcagctcccgcagcctcacaggctgctggtcggctggcactatctccaaggtgactgtgaaccccggcctgctggtgcccctggatgtcaagttggaccccgctgttcagcagctgaagaaccaggagaaggaggagatgaaggccctcaatgataaatttgcctccctaattggcaaggtgcaagccctggaacagcgcaaccagctgctggagacacgctggagcttcctgcagggccaggactcagccatcttcgacctcgggcatctctatgaggaatatcagggccggctgcaggaggaactgcgcaaagtgagccaggagcgggggcagctggaggccaacctgctgcaggtgctggagaaggttgaggagtttcgaatcaggtatgaggatgagatctccaagcgcacagacatggagttcacctttgttcagctgaagaaggacctggatgcagagtgtcttcatcggactgaactggaaaccaagttaaaaagcctggagag...

specific Embodiment approach 3

[0045] To verify the interference efficiency of siRNA on KRT80 in PC9 and A549 lung cancer cells, the specific steps are as follows: 1. Resuscitate A549 and PC-9 human lung cancer cells, and culture them with RPMI-1640 containing 10% fetal bovine serum at 37°C and 5% CO 2 Cells were grown in a cell culture incubator.

[0046] 2. A549 and PC-9 cells in the logarithmic growth phase were seeded in 6-well culture plates (2×10 5 per well), and transfected with siRNA 8 hours later.

[0047] 3. Abandon the medium in the 2 mesowells, and add 1.5 ml of RPM1-1640 medium containing 10% fetal bovine serum to each well.

[0048] 4. Take a 1.5ml EP tube, add 250ul opti-Men serum-free medium, 5ul Lip2000 liposome, 10ul siRNA working solution (20uM) to the tube, mix gently, and let stand at room temperature for 20min.

[0049] 5. Add the mixture in 4 into the well of 3, shake gently, and store at 37°C, 5% CO 2 cultured in a cell culture incubator and replaced with fresh medium after 10 hou...

specific Embodiment approach 4

[0053] Detection of siRNA in the present invention suppresses the impact of the KRT80 gene on the biological function of lung cancer cells, and the specific steps are as follows:

[0054] 1. According to the method in Embodiment 3, PC9 and A549 lung cancer cells were transfected with two siRNAs that inhibited the KRT80 gene.

[0055] 2. After 48 hours of transfection, the cell proliferation activity was detected by the MTS method. The specific method was: 10 3 Seed cells in a good growth state in a 96-well plate, add 150ul of medium to each well, place in a 5% CO2 incubator at 37°C for 1 day, add 30ul of MTS solution (5mg / ml) to each well, and continue to incubate for 2 hours; selection The absorbance of each well was measured at a wavelength of 490 nm, and the detection was continued for 4 days.

[0056] Such as image 3 Shown is the change of proliferation ability of lung cancer cells after siRNA interference with human KRT80 gene, from image 3 It can be seen that, compa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention aims at illuminating expression situation and actions of a KRT80 gene in lung cancer in accordance with research status of the KRT80 gene. According to the technical scheme, the purpose of the invention is achieved by the following steps: 1, detecting expression situation of KRT80 protein in clinical lung cancer; 2, researching siRNA which can achieve specific inhibition on the KRT80 gene; 3, detecting expression of the KRT80 protein by virtue of Western blot, verifying an inhibiting efficiency of the siRNA in the step 2, and screening out an siRNA sequence which can achieve specific inhibition on the KRT80 protein; and 4, detecting influence of the KRT80 gene on biological functions of lung cancer cells.

Description

technical field [0001] The invention belongs to the fields of molecular biology and oncology, and specifically relates to a human keratin gene KRT80 and its expression and application in lung cancer. Background technique [0002] Keratin is an intermediate filament protein in cytoskeletal proteins, and this family protein is the largest and most complex class in the cytoskeletal intermediate filament protein family. The epithelial keratin family is divided into type I and type II keratin, the type II keratin family includes: K9-K28; the type II keratin family includes 20 members: K1-K8 and K71-K80. Epithelial keratin widely exists in epithelial cells, and its main function is to participate in the formation of epithelial cell intermediate fibers, which plays an important role in maintaining the stability and integrity of epithelial cells and tissues. [0003] Studies have found that some keratin molecules are closely related to malignant tumors, and their abnormal expressio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11A61K31/713A61P35/00
CPCC12N15/113A61K31/713C12N2310/14
Inventor 宋鑫付桥粉孟旭东
Owner 信雅生物科技(苏州)有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap