Primer probe combination, PCR reaction fluid, kit and application thereof
A primer probe and reaction solution technology, applied in the biological field, can solve the problems of false positive quantitative results, high genome homology, misleading clinical diagnosis, etc., and achieve the effect of reducing the false negative rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] A primer-probe combination for the detection of Bordetella pertussis.
[0045] The combination of primers and probes provided by the present invention includes primers for detecting Bordetella pertussis and probes for detecting Bordetella pertussis, the primers for detecting Bordetella pertussis include upstream primers and downstream primers primers, where
[0046] The upstream primer for detecting Bordetella pertussis is shown in SEQ ID NO.1 in the sequence listing:
[0047] 5'-GGCCGGTGTTCATGGATTCG-3';
[0048] The downstream primers for detecting Bordetella pertussis are shown in SEQ ID NO.2 in the sequence listing:
[0049] 5'-CCCACCGGAATCAACAGCTTG-3';
[0050]The probe for detecting Bordetella pertussis is shown in SEQ ID NO.3 in the sequence listing:
[0051] 5'-FAM-CCGGCCAGCGGATCAACCCGCC-TAMRA-3'.
[0052] Wherein, the FAM connected to the 5' end of the probe for detecting Bordetella pertussis is a fluorescent group, and the TAMRA group connected to the 3' e...
Embodiment 2
[0054] A PCR reaction solution for detecting Bordetella pertussis.
[0055] The PCR reaction solution provided by the present invention includes: the primers for detecting Bordetella pertussis described in Example 1 and the probes for detecting Bordetella pertussis, fluorescent quantitative PCR amplification reagents, internal standard plasmids and Primers for amplifying internal standard fragments in internal standard plasmids and probes for detecting internal standard fragments. After mixing the components, add ultrapure water to make up the system to 25 μl to become a PCR reaction solution.
[0056] The primers for detecting Bordetella pertussis include: upstream primers for detecting Bordetella pertussis and downstream primers for detecting Bordetella pertussis, and upstream primers for detecting Bordetella pertussis and detection The final concentration of the downstream primers of Bordetella pertussis was 0.8 μM, and the final concentration of the probe for detecting Bo...
Embodiment 3
[0069] A kit for the detection of Bordetella pertussis.
[0070] The kit for detecting Bordetella pertussis provided by the invention comprises: PCR reaction solution, negative quality control product, positive quality control product and working standard product.
[0071] Wherein, the PCR reaction solution is as described in Example 2, and will not be repeated here.
[0072] Described negative quality control product is physiological saline.
[0073] The positive quality control product is 1×10 5 copy / ml of the Bordetella pertussis gene fragment recombinant plasmid using pUC57 as the carrier; wherein, the DNA sequence of the Bordetella pertussis gene fragment recombinant plasmid is shown in SEQ ID NO.8 in the sequence table:
[0074] CGTGACCTCCACGCTGCTCGTCCCCTGCGCTATTCTGTCCTCGCGGCTGCCGCGCCACAAGCAGATCTGGATCGAGATTTTCGGGGTGGTGTTCTTTCTGCTGCCGGCGTGCACCCTGATCATGGTTCTGTCGTGGCCGGTGTTCATGGATTCGTACCTGAGCGGCGAGCAGTCGTCGAACTCGGGCGGGTTGATCCGCTGGCCGGTCAAGCTGTTGATTCCGGTGGGGTTTGCGCTGCTGGTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


