Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer probe combination, PCR reaction fluid, kit and application thereof

A primer probe and reaction solution technology, applied in the biological field, can solve the problems of false positive quantitative results, high genome homology, misleading clinical diagnosis, etc., and achieve the effect of reducing the false negative rate

Inactive Publication Date: 2017-11-10
SHENZHEN CHILDRENS HOSPITAL +1
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high genome homology among different species of Bordetella, the primers and probes in some kits will non-specifically detect Bordetella hallii or Bordetella bronchiseptica, resulting in False positive or inaccurate quantitative results can easily mislead clinical diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe combination, PCR reaction fluid, kit and application thereof
  • Primer probe combination, PCR reaction fluid, kit and application thereof
  • Primer probe combination, PCR reaction fluid, kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A primer-probe combination for the detection of Bordetella pertussis.

[0045] The combination of primers and probes provided by the present invention includes primers for detecting Bordetella pertussis and probes for detecting Bordetella pertussis, the primers for detecting Bordetella pertussis include upstream primers and downstream primers primers, where

[0046] The upstream primer for detecting Bordetella pertussis is shown in SEQ ID NO.1 in the sequence listing:

[0047] 5'-GGCCGGTGTTCATGGATTCG-3';

[0048] The downstream primers for detecting Bordetella pertussis are shown in SEQ ID NO.2 in the sequence listing:

[0049] 5'-CCCACCGGAATCAACAGCTTG-3';

[0050]The probe for detecting Bordetella pertussis is shown in SEQ ID NO.3 in the sequence listing:

[0051] 5'-FAM-CCGGCCAGCGGATCAACCCGCC-TAMRA-3'.

[0052] Wherein, the FAM connected to the 5' end of the probe for detecting Bordetella pertussis is a fluorescent group, and the TAMRA group connected to the 3' e...

Embodiment 2

[0054] A PCR reaction solution for detecting Bordetella pertussis.

[0055] The PCR reaction solution provided by the present invention includes: the primers for detecting Bordetella pertussis described in Example 1 and the probes for detecting Bordetella pertussis, fluorescent quantitative PCR amplification reagents, internal standard plasmids and Primers for amplifying internal standard fragments in internal standard plasmids and probes for detecting internal standard fragments. After mixing the components, add ultrapure water to make up the system to 25 μl to become a PCR reaction solution.

[0056] The primers for detecting Bordetella pertussis include: upstream primers for detecting Bordetella pertussis and downstream primers for detecting Bordetella pertussis, and upstream primers for detecting Bordetella pertussis and detection The final concentration of the downstream primers of Bordetella pertussis was 0.8 μM, and the final concentration of the probe for detecting Bo...

Embodiment 3

[0069] A kit for the detection of Bordetella pertussis.

[0070] The kit for detecting Bordetella pertussis provided by the invention comprises: PCR reaction solution, negative quality control product, positive quality control product and working standard product.

[0071] Wherein, the PCR reaction solution is as described in Example 2, and will not be repeated here.

[0072] Described negative quality control product is physiological saline.

[0073] The positive quality control product is 1×10 5 copy / ml of the Bordetella pertussis gene fragment recombinant plasmid using pUC57 as the carrier; wherein, the DNA sequence of the Bordetella pertussis gene fragment recombinant plasmid is shown in SEQ ID NO.8 in the sequence table:

[0074] CGTGACCTCCACGCTGCTCGTCCCCTGCGCTATTCTGTCCTCGCGGCTGCCGCGCCACAAGCAGATCTGGATCGAGATTTTCGGGGTGGTGTTCTTTCTGCTGCCGGCGTGCACCCTGATCATGGTTCTGTCGTGGCCGGTGTTCATGGATTCGTACCTGAGCGGCGAGCAGTCGTCGAACTCGGGCGGGTTGATCCGCTGGCCGGTCAAGCTGTTGATTCCGGTGGGGTTTGCGCTGCTGGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer probe combination. The primer probe combination includes primers and a probe for detecting Bordetella pertussis, the primers for detecting the Bordetella pertussis includes an upstream primer and a downstream primer, wherein the upstream primer for detecting Bordetella pertussis is shown as SEQ ID NO. 1 in a sequence table; the downstream primer for detecting Bordetella pertussis is shown as SEQ ID NO. 2 in the sequence table; the probe used for detecting Bordetella pertussis is shown as SEQ ID NO. 3 in the sequence table. Based on the primer probe combination, the invention further provides a PCR reaction liquid, a kit and an application thereof. According to the primer probe combination and the kit, the primer pair and the probe with good specificity are designed based on the gene sequence of Bordetella pertussis, the kit can only detect Bordetella pertussis, and the specificity of the kit is good.

Description

【Technical field】 [0001] The invention relates to the field of biotechnology, in particular to a primer-probe combination / PCR reaction liquid, a kit and an application thereof for detecting Bordetella pertussis. 【Background technique】 [0002] Bordetella Pertussis is a Gram-negative bacillus that is the causative bacterium of whooping cough and is only pathogenic to humans. The typical course of whooping cough lasts several weeks and can be divided into 3 phases. Catarrhic phase (1-2 weeks): runny nose, low-grade fever, rhinitis and mild cough (apnea / respiratory failure may occur in infants). Spasmodic cough period (2-6 weeks): Paroxysmal spasmodic cough, mostly dry cough, followed by deep inhalation, "cock crowing" roar and coughing sound, followed by vomiting. Recovery period (≥2 weeks): The frequency and severity of coughing attacks gradually decrease. The incubation period of Bordetella pertussis is 5-21 days, with an average of 7 days. The patient was contagious fro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/689C12Q2600/16C12Q2600/166
Inventor 马东礼姜含芳刘孝荣陈虹宇蔡德丰朱纯青李俊农文燕
Owner SHENZHEN CHILDRENS HOSPITAL