Method for utilizing PCR product to restrain insect gene expression
A gene expression and product inhibition technology, applied in the field of insect gene expression inhibition, can solve the problems of insects that have not been reported, and achieve the effects of easy acquisition and preservation, inhibition of gene expression, and simple and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] 1. Determine the Plutella xylostella tanning hormone α subunit gene as the target gene, and design a pair of primers using the Plutella xylostella xylostella genome database α subunit gene as a template.
[0032] Upstream primer 01F: 5'- GATTTAACTGTTTGTCAAATGCA -3'
[0033] Upstream primer 01R: 5'- ACACTGATCAAGAGATTTATTATAGT -3'
[0034] PCR was carried out with the above primers, and a PCR product of about 750bp (including part of 5'UTR and 3'UTR) was obtained. 1shown.
[0035] 2. The amplification primers for the second segment of the exon and the second segment of the intron of the Plutella xylostella tanning hormone α subunit gene are as follows, after PCR amplification and purification, the product obtained by dilution (exon SEQ ID NO. 2 , intron SEQ ID NO. 3). The dilution concentration is 100 ng / μL, 170 ng / μL, 280 ng / μL, 400 ng / μL.
[0036] Upstream primer Exon2-F: 5'- AGGTTTCGGGAAGTAAAATCTG -3'
[0037] Upstream primer Exon2-R: 5'- TTCGAAACTTCTTATCTTCACTTTT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap