Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for utilizing PCR product to restrain insect gene expression

A gene expression and product inhibition technology, applied in the field of insect gene expression inhibition, can solve the problems of insects that have not been reported, and achieve the effects of easy acquisition and preservation, inhibition of gene expression, and simple and easy operation

Active Publication Date: 2017-12-08
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although the phenomenon that PCR products inhibit gene expression has been found in some organisms, it has not been reported in insects so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for utilizing PCR product to restrain insect gene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Determine the Plutella xylostella tanning hormone α subunit gene as the target gene, and design a pair of primers using the Plutella xylostella xylostella genome database α subunit gene as a template.

[0032] Upstream primer 01F: 5'- GATTTAACTGTTTGTCAAATGCA -3'

[0033] Upstream primer 01R: 5'- ACACTGATCAAGAGATTTATTATAGT -3'

[0034] PCR was carried out with the above primers, and a PCR product of about 750bp (including part of 5'UTR and 3'UTR) was obtained. 1shown.

[0035] 2. The amplification primers for the second segment of the exon and the second segment of the intron of the Plutella xylostella tanning hormone α subunit gene are as follows, after PCR amplification and purification, the product obtained by dilution (exon SEQ ID NO. 2 , intron SEQ ID NO. 3). The dilution concentration is 100 ng / μL, 170 ng / μL, 280 ng / μL, 400 ng / μL.

[0036] Upstream primer Exon2-F: 5'- AGGTTTCGGGAAGTAAAATCTG -3'

[0037] Upstream primer Exon2-R: 5'- TTCGAAACTTCTTATCTTCACTTTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for utilizing a PCR product to restrain the insect gene expression. The method for utilizing the PCR product to restrain the insect gene expression sequentially includes the following steps that 1, a target gene of an insect is determined, and a complete genome sequence of the gene is obtained through PCR amplification and sequencing is conducted; 2, a DNA fragment of an experiment is determined according to the DNA sequence obtained in the step 1, and PCR amplification is conducted and the DNA fragment is purified; 3, the DNA fragment obtained in the step 2 is injected into the body of the insect by utilizing a microinjection method; and 4, detection of RT-qPCR is conducted on the insect in the step 3, and the relative expression level of the target gene is determined.

Description

technical field [0001] The invention relates to a method for inhibiting gene expression of insects by utilizing PCR products, and belongs to the field of biotechnology. Background technique [0002] Homology-dependent gene silencing is widely used in the research of molecular biology, which mainly reduces the synthesis of protein by reducing the transcription product, thus making it lose its original function. Most of the homologous fragments currently used to regulate gene expression are antisense RNA and double-stranded RNA; with the discovery of research, the introduction of DNA fragments can also cause gene silencing, which is called DNA interference. [0003] Current studies have pointed out that introducing dsDNA fragments of Adiantum endogenous genes into gametophytic cells can cause gene silencing and reduce the expression of endogenous genes (Kawai-Toyooka H., Kuramoto C., Orui K., et al .DNA Interference: a Simple and Efficient Gene-Silencing System for High-Throu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89
CPCC12N15/89
Inventor 杨广芮祥云陈金芝黄鹏榕尤民生
Owner FUJIAN AGRI & FORESTRY UNIV