Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of drought resistance relevant soybean protein in drought resistance of soybeans

A technology related to protein and drought resistance, applied in the application, the use of vectors to introduce foreign genetic material, angiosperms/flowering plants, etc., can solve the problem of less drought-resistant transgenic soybean breeding, etc.

Active Publication Date: 2017-12-12
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few reports on soybean drought-resistant transgenic breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of drought resistance relevant soybean protein in drought resistance of soybeans
  • Application of drought resistance relevant soybean protein in drought resistance of soybeans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1, Soybean Drought Resistance-related Protein GmSQE1 Can Regulate Soybean Drought Resistance

[0082] This embodiment provides a soybean drought-resistance-related protein derived from soybean variety willam82, which is named GmSQE1, and the sequence of GmSQE1 is sequence 1 in the sequence listing. In soybean variety willam82, the CDS sequence of GmSQE1 is sequence 2 in the sequence listing, and the genome sequence is sequence 3 in the sequence listing.

[0083] The DNA molecule shown in Sequence 2 (i.e. the GmSQE1 encoding gene) is transferred to soybean to detect the function of GmSQE1 in regulating soybean, the specific method is as follows:

[0084] 1. Construction of GmSQE1 expression recombinant vector and recombinant bacteria

[0085] The primer pair consisting of upstream primer (F: AGGCTTTGACTTTAGGTC ATGATGGGTTATGAGTATATTTTGG) and downstream primer (R: GTCTAGAGACTTTAGGTC TTAATCTTCCAAATTGGTAGGG) was used to amplify the cDNA of soybean variety willam82 b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a drought resistance relevant soybean protein in the drought resistance of soybeans. The drought resistance relevant soybean protein (GmSQE1) is as shown in A1), A2) or A3): A1) a protein with an amino acid sequence represented by a sequence 1; A2) a protein which is obtained from the amino acid sequence represented by the sequence 1 through substitution and / or deletion and / or addition of one or several amino acid residues, has the same function and is derived from A1); and A3) a fusion protein obtained by connecting a label to an terminal N and / or C of A1) or A2). Experiments prove that compared with a plant which is not genetically modified by a GmSQE1 gene, a positive plant which is genetically modified by the GmSQE1 gene presents drought resistance after being subjected to drought condition; after rehydration treatment, the plant which is not genetically modified by the GmSQE1 gene is dead, and the positive plant which is genetically modified by the GmSQE1 gene can normally grow, so that the GmSQE1 gene and an encoding gene of the GmSQE1 gene are capable of improving the drought resistance of the plants.

Description

technical field [0001] The invention relates to the application of soybean drought-resistance-related protein in regulating soybean drought-resistance in the field of biotechnology. Background technique [0002] With global warming and increasing land desertification, drought has become an extremely important factor threatening global agricultural development and food security. Drought stress can cause the wilting and stunting of crops, which in turn leads to crop yield reduction. It is very difficult to change the general trend of global warming in a short period of time, so cultivating crops with drought resistance through modern biotechnology is a good solution. [0003] Soybean (Glycine max) is one of the five major economic crops that originate in China and have important food security status in the world. my country is the world's largest importer and consumer of soybeans, and soybeans are of great strategic significance to ensure the security of my country's oil sup...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00
CPCC07K14/415C12N15/8273
Inventor 矫永庆沈欣杰王岩岩包爱丽张永兴郭葳周新安
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com