Over-expressed lentiviral vector of cdtB gene and construction method thereof as well as lentivirus containing cdtB gene and application thereof
A lentiviral vector and gene overexpression technology, applied in the field of lentivirus, can solve the problems of affecting the function of cdtB protein, hindering the progress of cdtB gene research, and difficult to enter cdtB protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0074] The present invention provides a lentivirus containing cdtB gene, which is prepared by the following steps:
[0075] Ⅰ. Mix the pLVX-AcGFP1-N1-cdtB constructed by the above technical scheme with VSVG and pCMVΔR8.2 according to the mass ratio of 2:1:1 to obtain the plasmid mixture;
[0076] Ⅱ. Mix the plasmid mixture and liposome according to the volume ratio of 8:15, let it stand still, add the mixture after standing still to the cells cultured in serum-free DMEM, and after culturing for 7 hours, replace the medium to complete Culture medium;
[0077] III. The cells were cultured for 48 hours under the condition of complete medium, and the cell supernatant was collected and filtered to obtain the lentivirus containing the cdtB gene.
[0078] In the present invention, the pLVX-AcGFP1-N1-cdtB constructed by the above technical scheme is mixed with VSVG and pCMVΔR8.2 according to the mass ratio of 2:1:1 to obtain a plasmid mixture. The VSVG is an expression plasmid with ...
Embodiment 1
[0093] In the following examples, the experimental methods for which specific conditions are not indicated are generally in accordance with conventional conditions, such as "Refined Molecular Biology Experiment Guide" (F.M. The translation. Beijing: Science Press, 2004) method described in.
[0094] Design specific primers to amplify the cdtB fragment. The primer sequences are as follows:
[0095] CDTB-F CCG CTCGAG ATGAGAATACTATTATGCTT
[0096] wxya
[0097] CDTB-R CGC GGATCC CTCCTAAAAATCGTCCAAA
[0098] BamHI
[0099] The PCR reaction system is shown in Table 1:
[0100]
[0101] The PCR reaction program is shown in Table 2:
[0102]
[0103] 1% agarose gel electrophoresis detects the PCR product, and the band is in line with expectations at about 800bp ( figure 1 ). Among them, the band size is 837bp; 1 is a positive sample, 2 is a blank control, and 3 is a 200bp Marker.
Embodiment 2
[0105] The PCR product was recovered by gel, the cdtB fragment was connected to the T vector using a T vector ligation kit, transformed into E. coli competent cells, positive colonies were selected for expansion, and the T vector with the cdtB fragment was extracted using a plasmid extraction kit.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com