Supercharge Your Innovation With Domain-Expert AI Agents!

NK cell capable of efficiently and stably expressing antibody and application thereof

A technology of NK cells and antibodies, which is applied in the fields of cell biology and oncology, and can solve the problems of low transfection rate of NK cells, difficulty in high-efficiency expression, difficulty in packaging and preparation, etc.

Pending Publication Date: 2017-12-29
SHANGHAI CELL THERAPY RES INST +1
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although there have been reports of transfection of exogenous genes into NK cells, the transfection rate of NK cells in commonly used gene transfection vector systems is low, or it is difficult to express high levels of exogenous genes in their cells
The use of adenovirus vectors (non-integrated) can mediate the efficient short-term expression of foreign genes in NK cells, but the proliferation of activated NK cells is very fast, and the expression cassettes of foreign genes carried will be quickly lost during cell passage , the expression is difficult to last; the integration of exogenous genes in the NK cell genome can be mediated by retrovirus or lentivirus, and stable expression can be achieved in theory, but the antibody contains light chain and heavy chain, and the coding sequence is long and the molecular weight is large, resulting in Retroviruses or lentiviruses carrying full-length antibody expression cassettes are difficult to package and prepare, and it is difficult to express antibodies efficiently. They can only be used to express single-chain antibodies with simple structures (lack of Fc fragments, incomplete function and short half-life)
Therefore, before this, there are no reports of transgenic NK cells that have cytotoxicity and can stably and high-level express antibodies containing human Fc fragments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NK cell capable of efficiently and stably expressing antibody and application thereof
  • NK cell capable of efficiently and stably expressing antibody and application thereof
  • NK cell capable of efficiently and stably expressing antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1: Construction of recombinant plasmids pS838-AntiHER2 and pNB328-CD20BR

[0085] Entrusted Shanghai Jereh Biological Company to synthesize two DNA sequences, the sequences are as follows:

[0086] Seq1: CGATAGGACGCTGATCTTAAT (SEQ ID NO: 1);

[0087] Seq2: TACCTGCGACTAGAAT (SEQ ID NO: 2).

[0088] Denaturation at 98°C for 5 minutes, followed by natural cooling to form double-stranded DNA adapters with ClaI and PacI sticky ends at the upstream and downstream respectively.

[0089] The pNB vector was double-digested with CalI and PacI (refer to CN201510638974.7 for the construction process), and loaded with the above double-stranded DNA to obtain the pS vector.

[0090] According to the CCEF promoter sequence published in CN201510021408.1, Shanghai Jereh Biological Co., Ltd. was commissioned to synthesize it, and introduced XbaI and EcoRI restriction sites in the upstream and downstream, respectively, and loaded it into the pS vector double-digested by XbaI an...

Embodiment 2

[0098] Example 2: Genetic modification of peripheral blood-derived NK cells

[0099] Peripheral blood mononuclear cells (PBMC) were freshly isolated and placed in a culture plate containing 30 ng / mL anti-CD16 antibody, 500 IU / mL IL-21 (purchased from Novoprotein Company), 3 ml NK medium (purchased from STEMCELL Technologies), 37°C, 5% CO 2 Incubator culture. Collect 5×10 6 For NK cells, pNB328-CD20BR and pS838-antiHER2 were co-transfected into the nuclei by a Lonza 2b-Nucleofector instrument at a ratio of 1:2. After the cells grow healthily, the pluripotent NK cells expressing HER2 antibody, referred to as PIK-NK, are obtained. Since only the pNB328 vector contains the transposase required for exogenous gene integration, and the pS838 vector only contains the ITR element required for transposition, only the cells transfected with pNB328-CD20BR and pS838-antiHER2 vector can realize HER2 antibody The integration of the expression cassette ensures that all PIK-NK cells cont...

Embodiment 3

[0100] Example 3: Quantitative detection of HER2 antibody expression in PIK-NK cells

[0101] The PIK-NK and control NK cells prepared in Example 2 were subcultured at a dilution ratio of 1:3, and 1.0×10 6 Cells / well were plated in a 6-well plate with NK medium (purchased from STEMCELL Technologies) and placed at 37°C in 5% CO 2Culture in an incubator, and collect 800 μl of cell supernatant after 24 hours, 48 ​​hours, 72 hours, and 96 hours of culture, and store at -20°C for future use. Human-derived HER2 recombinant protein was used to coat the enzyme plate (purchased from SinoBiological Company), detected with HRP-labeled mouse anti-human IgG mAb (purchased from Abcam Company), and commercialized HER2 antibody (Herceptin, purchased from Roche Company) As a standard, the expression level of HER2 antibody was detected by double-sandwich ELISA method.

[0102] As a result, it was found that PIK-NK cells from two different donors could express HER2 antibody at a high level a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a NK cell capable of efficiently and stably expressing an antibody and application thereof. Specifically, the invention provides the transgenic NK cell, and the genome of the transgenic NK cell is stably integrated with an expression cassette containing a coding sequence of an antibody of a human Fc segment, wherein two ends of the expression cassette contain inverted terminal repeats of transposons. The transgenic NK cell provided by the invention can maintain cell killing toxicity and stably express the antibody of the human Fc segment at a high level. Moreover, a molecular brake system is introduced to prevent systematic toxicity and autoimmune diseases caused by excess expression of antibodies due to continuous propagation of stably expressed antibodies in immune cells. Commercially available monoclonal antibody drugs can be used for rapidly removal of killer cells integrated with the expression cassettes of antibodies, so treatment security is effectively improved.

Description

technical field [0001] The invention belongs to the field of cell biology and oncology, and relates to an NK cell expressing an antibody efficiently and stably and its application. Background technique [0002] Cancer has now become the number one killer of human health. The fast pace of life, huge work pressure, unhealthy eating habits, and poor environment are all accomplices to the occurrence of cancer, making the high incidence and younger trend of cancer more and more obvious. At present, the efficacy of traditional treatment methods has reached the bottleneck, and it is urgent to explore a more effective treatment method to improve the survival rate and quality of life of cancer patients. Immunotherapy against malignant tumors has developed rapidly in recent years and has achieved remarkable clinical efficacy. In 2011, Nature and JCO, the top journal of clinical oncology, respectively published review articles with the same title "The era of tumor immunotherapy has co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10A61K35/17A61P35/00A61P31/12A61P31/04A61P37/02C12N15/85
CPCA61K35/17C12N5/0646C12N15/85C12N2510/00C12N2800/107C12N2800/90
Inventor 钱其军金华君刘辉李林芳叶真龙王超崔连振吴红平
Owner SHANGHAI CELL THERAPY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More