NK cell capable of efficiently and stably expressing antibody and application thereof
A technology of NK cells and antibodies, which is applied in the fields of cell biology and oncology, and can solve the problems of low transfection rate of NK cells, difficulty in high-efficiency expression, difficulty in packaging and preparation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] Example 1: Construction of recombinant plasmids pS838-AntiHER2 and pNB328-CD20BR
[0085] Entrusted Shanghai Jereh Biological Company to synthesize two DNA sequences, the sequences are as follows:
[0086] Seq1: CGATAGGACGCTGATCTTAAT (SEQ ID NO: 1);
[0087] Seq2: TACCTGCGACTAGAAT (SEQ ID NO: 2).
[0088] Denaturation at 98°C for 5 minutes, followed by natural cooling to form double-stranded DNA adapters with ClaI and PacI sticky ends at the upstream and downstream respectively.
[0089] The pNB vector was double-digested with CalI and PacI (refer to CN201510638974.7 for the construction process), and loaded with the above double-stranded DNA to obtain the pS vector.
[0090] According to the CCEF promoter sequence published in CN201510021408.1, Shanghai Jereh Biological Co., Ltd. was commissioned to synthesize it, and introduced XbaI and EcoRI restriction sites in the upstream and downstream, respectively, and loaded it into the pS vector double-digested by XbaI an...
Embodiment 2
[0098] Example 2: Genetic modification of peripheral blood-derived NK cells
[0099] Peripheral blood mononuclear cells (PBMC) were freshly isolated and placed in a culture plate containing 30 ng / mL anti-CD16 antibody, 500 IU / mL IL-21 (purchased from Novoprotein Company), 3 ml NK medium (purchased from STEMCELL Technologies), 37°C, 5% CO 2 Incubator culture. Collect 5×10 6 For NK cells, pNB328-CD20BR and pS838-antiHER2 were co-transfected into the nuclei by a Lonza 2b-Nucleofector instrument at a ratio of 1:2. After the cells grow healthily, the pluripotent NK cells expressing HER2 antibody, referred to as PIK-NK, are obtained. Since only the pNB328 vector contains the transposase required for exogenous gene integration, and the pS838 vector only contains the ITR element required for transposition, only the cells transfected with pNB328-CD20BR and pS838-antiHER2 vector can realize HER2 antibody The integration of the expression cassette ensures that all PIK-NK cells cont...
Embodiment 3
[0100] Example 3: Quantitative detection of HER2 antibody expression in PIK-NK cells
[0101] The PIK-NK and control NK cells prepared in Example 2 were subcultured at a dilution ratio of 1:3, and 1.0×10 6 Cells / well were plated in a 6-well plate with NK medium (purchased from STEMCELL Technologies) and placed at 37°C in 5% CO 2Culture in an incubator, and collect 800 μl of cell supernatant after 24 hours, 48 hours, 72 hours, and 96 hours of culture, and store at -20°C for future use. Human-derived HER2 recombinant protein was used to coat the enzyme plate (purchased from SinoBiological Company), detected with HRP-labeled mouse anti-human IgG mAb (purchased from Abcam Company), and commercialized HER2 antibody (Herceptin, purchased from Roche Company) As a standard, the expression level of HER2 antibody was detected by double-sandwich ELISA method.
[0102] As a result, it was found that PIK-NK cells from two different donors could express HER2 antibody at a high level a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap