Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer set and kit for detecting fragile X syndrome

A detection kit and the technology of the kit, applied in the field of medical detection, can solve the problems of false negative, low detection specificity and sensitivity, inappropriate calculation formula, etc., and achieve the effect of avoiding missed detection and improving detection methods.

Inactive Publication Date: 2017-12-29
GUANGZHOU DARUI BIOTECH
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high GC content, the specificity and sensitivity of this technology for the detection of female fragile X syndrome carriers or chimeras is low, and false negatives are prone to occur
Chinese patent (CN103981253A) discloses a PCR kit for detecting CGG multiplicity and AGG insertion information of fragile X syndrome. The primers for AGG insertion information in this patent are S+(CGG)4AGG, S+(GCG)4GAG , S+(GGC)4GGA or their reverse complementary sequences S+(GCC)4TCC, S+(CGC)4CTC, S+(CCG)4CCT, these primers are all primers designed on the sequence of AGG and can only recognize fragile X synthesis wild-type samples, and the CGG repeat number of the DNA of the fragile X syndrome sample is too high and there is no AGG insertion, the primer sequence cannot determine whether the sample without AGG insertion information is fragile X syndrome or the experiment fails. The calculation formula is also not suitable for
Therefore, this patent can only judge the CGG repeat number of normal samples, but cannot judge whether it is a carrier of Fragile X syndrome, which has great limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set and kit for detecting fragile X syndrome
  • Primer set and kit for detecting fragile X syndrome
  • Primer set and kit for detecting fragile X syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Design of Fragile X Syndrome Detection Primers

[0041] (1) Design primers F and R for amplifying and detecting the target fragment (including the CGG repeat region) at both ends of the CGG repeat sequence of the FMR1 gene, and design primer M for amplifying and detecting the CGG repeat sequence in the CGG repeat region. Incremental principles such as figure 1 Shown; The sequence of the upstream primer F for detecting CGG repeat number and detecting AGG insertion information is shown in SEQ ID NO: 1, and its 5' end has FAM fluorescence; the sequence of the downstream primer R for detecting CGG repeat number is shown in SEQ ID NO: 2; the sequence of the downstream primer M for detecting AGG insertion information is shown in SEQ ID NO: 3; the specific primer sequence is shown in Table 1:

[0042] Table 1

[0043] serial number

Primer (3'-5')

SEQ ID NO:1

FAM-TCAGGCGCTCAGCTCCGTTTCGGTTTCA

SEQ ID NO:2

AAGCGCCATTGGAGCCCCGCACTTCC ...

Embodiment 2

[0047] Example 2 Detection of CGG Repeat Number and AGG Insertion Information in Normal Male Samples

[0048] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. Genomic DNA extraction kit from QIAGEN Company was used to extract, and its concentration was measured to be 40ng / μL by fluorescence quantification instrument.

[0049] (2) Use the primer set in Example 1 to prepare a PCR reaction system, and perform fluorescent PCR amplification of two reaction systems on the sample, one system is for amplifying the CGG repeat number fragment, and the other system is for amplifying the inserted AGG information; Except for the different primer pairs, the two systems have the same reaction system and reaction procedures. Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube, and the PCR amplification system is as follows:

[0050] 2×GC BufferⅠ 10μL

[0051] dNTPs (10mmol / L) 0.4μL

[0052] PCR enhancer 5...

Embodiment 3

[0063] Example 3 Detection of CGG Repeat Number and AGG Insertion Information in Normal Female Samples

[0064] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. Genomic DNA extraction kit from QIAGEN Company was used to extract, and its concentration was measured to be 40ng / μL by fluorescence quantification instrument.

[0065] (2) Use the primer set in Example 1 to prepare a PCR reaction system, and perform fluorescent PCR amplification of two reaction systems on the sample, one system is for amplifying the CGG repeat number fragment, and the other system is for amplifying the inserted AGG information; Except for the different primer pairs, the two systems have the same reaction system and reaction procedures. Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube, and the PCR amplification system is as follows:

[0066] 2×GC BufferⅠ 10μL

[0067] dNTPs (10mmol / L) 0.4μL

[0068] PCR enhancer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set and a kit for detecting a fragile X syndrome. The kit comprises the primer set for detecting the fragile X syndrome, wherein the primer set comprises a forward primer F and a reverse primer R for detecting the CGG repeat number as well as the forward primer F and a reverse primer M for detecting AGG insertion information; the sequence of the forward primer F is as shown in SEQ ID NO: 1, and FAM fluorescence is formed at 5' end of the forward primer F; the sequence of the reverse primer R is as shown in SEQ ID NO: 2; the sequence of the reverse primer M is as shown in SEQ ID NO: 3. The kit can detect whether a sample is carried by front mutation or full mutation, thereby avoiding missing detection. A method is simple to operate, convenient, quick and low in cost. The kit has stronger specificity and higher sensitivity, and has larger application prospect.

Description

technical field [0001] The invention belongs to the technical field of medical detection. More specifically, it relates to a primer set and kit for detecting fragile X syndrome. Background technique [0002] Fragile X syndrome is the most common type of hereditary mental retardation next to congenital mental retardation, with an incidence rate of 1 / 2500~1 / 5000, and the incidence rate is about 6.3% among mentally retarded patients in my country. There are obvious gender differences in the incidence of the disease, and the incidence rate of men is higher. According to statistics, the incidence rate of men is 1:4000, and the incidence rate of women is 1:8000~1:6000. [0003] Fragile X syndrome is an X-linked incomplete dominant genetic disease caused by excessive methylation or complete alteration of X chromosome DNA. The causative gene of FXS is Fragile X Mental Retardation 1 Gene (FMR1). Most of FXS is caused by the excessive expansion of (CGG) n repeat sequence of FMR1, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2531/113C12Q2565/125C12Q2563/107
Inventor 李明吴英松杨学习杨旭叶倩平
Owner GUANGZHOU DARUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com