Primer set and kit for detecting fragile X syndrome
A detection kit and the technology of the kit, applied in the field of medical detection, can solve the problems of false negative, low detection specificity and sensitivity, inappropriate calculation formula, etc., and achieve the effect of avoiding missed detection and improving detection methods.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Design of Fragile X Syndrome Detection Primers
[0041] (1) Design primers F and R for amplifying and detecting the target fragment (including the CGG repeat region) at both ends of the CGG repeat sequence of the FMR1 gene, and design primer M for amplifying and detecting the CGG repeat sequence in the CGG repeat region. Incremental principles such as figure 1 Shown; The sequence of the upstream primer F for detecting CGG repeat number and detecting AGG insertion information is shown in SEQ ID NO: 1, and its 5' end has FAM fluorescence; the sequence of the downstream primer R for detecting CGG repeat number is shown in SEQ ID NO: 2; the sequence of the downstream primer M for detecting AGG insertion information is shown in SEQ ID NO: 3; the specific primer sequence is shown in Table 1:
[0042] Table 1
[0043] serial number
Primer (3'-5')
SEQ ID NO:1
FAM-TCAGGCGCTCAGCTCCGTTTCGGTTTCA
SEQ ID NO:2
AAGCGCCATTGGAGCCCCGCACTTCC ...
Embodiment 2
[0047] Example 2 Detection of CGG Repeat Number and AGG Insertion Information in Normal Male Samples
[0048] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. Genomic DNA extraction kit from QIAGEN Company was used to extract, and its concentration was measured to be 40ng / μL by fluorescence quantification instrument.
[0049] (2) Use the primer set in Example 1 to prepare a PCR reaction system, and perform fluorescent PCR amplification of two reaction systems on the sample, one system is for amplifying the CGG repeat number fragment, and the other system is for amplifying the inserted AGG information; Except for the different primer pairs, the two systems have the same reaction system and reaction procedures. Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube, and the PCR amplification system is as follows:
[0050] 2×GC BufferⅠ 10μL
[0051] dNTPs (10mmol / L) 0.4μL
[0052] PCR enhancer 5...
Embodiment 3
[0063] Example 3 Detection of CGG Repeat Number and AGG Insertion Information in Normal Female Samples
[0064] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. Genomic DNA extraction kit from QIAGEN Company was used to extract, and its concentration was measured to be 40ng / μL by fluorescence quantification instrument.
[0065] (2) Use the primer set in Example 1 to prepare a PCR reaction system, and perform fluorescent PCR amplification of two reaction systems on the sample, one system is for amplifying the CGG repeat number fragment, and the other system is for amplifying the inserted AGG information; Except for the different primer pairs, the two systems have the same reaction system and reaction procedures. Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube, and the PCR amplification system is as follows:
[0066] 2×GC BufferⅠ 10μL
[0067] dNTPs (10mmol / L) 0.4μL
[0068] PCR enhancer...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



