Supercharge Your Innovation With Domain-Expert AI Agents!

Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent

A technology of lnc03729, 1.lnc03729 is applied in the application field of pre-diagnostic reagents, and can solve problems such as the down-regulation of Lnc03729

Active Publication Date: 2018-03-16
CENT SOUTH UNIV +1
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Our study found that the expression of Lnc03729 was significantly down-regulated in lung adenocarcinoma, and there is no report on the relationship between Lnc03729 and malignant tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent
  • Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent
  • Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Real-time fluorescence quantitative PCR method detects the low expression of Lnc03729 in lung adenocarcinoma:

[0021] 1. Materials and methods

[0022] 1.1 Materials

[0023] RNA extraction reagent Trizol (#9109, Takara);

[0024] Reverse Transcription Kit (#A3500, Promega);

[0025] SYBR® Premix Ex Taq™ fluorescent dye (#RR420A, Takara);

[0026] Nuclease-free water (#10977023, Invitrogen).

[0027] 1.2 Method

[0028] 24 pairs of lung adenocarcinoma and adjacent tissues were collected, total RNA was extracted, and 1 μg was reverse-transcribed to obtain a cDNA template. Real-time fluorescent quantitative PCR was used to detect the expression level of Lnc03729 in the two tissues. Lnc03729 gene forward primer: 5'-TTGGTGGATGCTGACCTTCA -3'; reverse primer: 5'- ACCAGAAACCAGATGTAGCCA -3'; internal reference gene β-Actin forward primer: 5'-CACCATTGGCAATGAGCGGTTC-3'; reverse primer: 5'- AGGTCTTTGCGGATGTCCACGT-3'. The real-time fluorescent quantitative PCR rea...

Embodiment 2

[0042] Example 2 Construction of H358 and A549 lung adenocarcinoma cell lines stably overexpressing Lnc03729:

[0043] 1. Materials and methods

[0044] 1.1 Materials

[0045] Human lung adenocarcinoma cells H358, A549 and human embryonic kidney cells 293T (ATCC);

[0046] DMEM medium, 1640 medium, DMEM / F12 medium, fetal bovine serum and trypsin (Gibco)

[0047] Overexpression of Lnc03729 vector (Shandong Weizhen Biotechnology);

[0048] Lentiviral packaging vector Gag-Pol, REV, VSV-G (addgene);

[0049] EcoliDH5α competent cells (#D9057, Takara);

[0050] Plasmid Extraction Kit (#D6943-01, OMEGA);

[0051]Transfect liposomes with Lipofectamine® RNAiMAX Reagent (#13778150, Thermo Fisher Scientific);

[0052] Puromycin puromycin (Amresco);

[0053] Cationic polymer Polybrene (#28728-55-4, Sigma);

[0054] RNA extraction reagent Trizol (#9109, Takara);

[0055] Reverse Transcription Kit (#A3500, Promega);

[0056] SYBR® Premix Ex Taq™ fluorescent dye (#RR420A, Takara);...

Embodiment 3

[0065] Example 3 After up-regulating the expression of Lnc03729 in lung adenocarcinoma cells H358 and A549, the cell proliferation ability decreased:

[0066] 1. Materials and methods

[0067] 1.1 Materials

[0068] Cell counting plate (#145-0011, Bio-Rad);

[0069] MTS (#G3580, promega).

[0070] 1.2 Method

[0071] MTS detection of cell proliferation ability

[0072] Inoculate overexpressed Lnc03729 H358 and A549 cells in good growth state and corresponding Vector control cells in a 96-well plate at 2000 cells / well, set up 5 parallel wells, discard the old medium after the cells adhere to the wall, and add MTS reagent Mix evenly with 1640 + 10% fetal bovine serum (A549 uses DMEM / F12 + 10% fetal bovine serum) medium at a ratio of 1:9, add 100 μl / well to the corresponding cell wells to be tested, incubate at 37°C for 1 h, and detect at 490 nm Absorbance. Similarly, the absorbance at 490 nm of the cells was detected at 24 h, 48 h, and 72 h, and the relative proliferation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a Lnc03729 gene c as a biomarker in the preparation of markers for diagnosis, prognosis evaluation and therapeutic guidance of lung adenocarcinoma. RNA is extracted from lung adenocarcinoma and normal lung tissue samples and is reversely transcribed, the expression of Lnc03729 is detected through a real-time fluorescent quantitative PCR technology, the expression of human lung adenocarcinoma cell Lnc03729 is exogenously up-regulated, and the change of the proliferation and the metastasis of the cells is detected through MTS and Transwell experiments. Aresult shows that the Lnc03729 is under-expressed in the lung adenocarcinoma tissues, and the up-regulation of the expression of the human lung adenocarcinoma cells Lnc03729 significantly down-regulates the proliferation and metastasis ability of the cells, so it is prompted that the Lnc03729 can be used as a marker for the malignancy and the patient prognosis evaluation of the lung adenocarcinoma cells. The application provides a powerful molecular biology tool for the auxiliary diagnosis, prognosis prediction and therapeutic guidance of the lung adenocarcinoma, and has far-reaching clinicalsignificance and important promotion and application prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of Lnc03729 gene in the preparation of lung cancer diagnosis, prognosis evaluation and treatment guidance, and specifically relates to the application of Lnc03729 as a biomarker in the preparation of prediagnostic reagents for lung adenocarcinoma. Background technique [0002] Lung cancer is the most common malignant tumor with the highest mortality rate in the world. The situation of lung cancer in my country is also quite severe. In 2015, there were 733,300 new cases of lung cancer in my country and 610,200 deaths, making it the largest malignant tumor in my country. Lung cancer can be divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) according to histological type. The latter can be subdivided into lung adenocarcinoma, lung squamous cell carcinoma and large cell lung cancer. More than % is the main pathological type. Most lung adenoca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/166C12Q2600/178
Inventor 陶永光杨瑞
Owner CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More