Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A high-affinity anti-fgf-2 disulfide bond-stabilized human double-chain antibody and its application

A FGF-2 and double-chain antibody technology, applied in the direction of antibodies, applications, specific peptides, etc., can solve drug resistance and other problems, achieve the effect of improving affinity, inhibiting tumor angiogenesis, and promoting tumor angiogenesis

Active Publication Date: 2021-03-19
JINAN UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, long-term use of this antibody drug will compensatoryly promote the expression of bFGF and platelet-derived growth factor (PDGF), thereby promoting tumor angiogenesis, promoting tumor recurrence and growth, and leading to drug resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-affinity anti-fgf-2 disulfide bond-stabilized human double-chain antibody and its application
  • A high-affinity anti-fgf-2 disulfide bond-stabilized human double-chain antibody and its application
  • A high-affinity anti-fgf-2 disulfide bond-stabilized human double-chain antibody and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Obtaining the gene fragment of anti-FGF-2 human ds-Diabody:

[0037] Based on the VL gene and VH gene fragments encoding the anti-FGF-2 human scFv antibody (obtained by phage antibody display in the laboratory in the early stage, patent number ZL201110449568.8), the VL of the anti-FGF-2 human scFv antibody Amino acid Gly at position 103 and amino acid Gly at position 44 of VH were site-directed mutations to Cys, a covalent bond disulfide bond was introduced, and a linking peptide encoded by it was modified to: Linker with amino acid sequence GGGGS. The anti-FGF-2 human ds-Diabody was constructed by linking the variable regions of the antibody light and heavy chains through the modified Linker, namely VL-GGGGS-VH.

[0038] The nucleotide sequence (SEQ ID NO.7) encoding the light chain variable region of the anti-FGF-2 human scFv antibody is as follows:

[0039] CAGTCTGTGTTGACGCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACC ATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCT...

Embodiment 2

[0043] FGF-2 and anti-FGF-2 human ds-Diabody molecular space structure simulation homology modeling:

[0044] The cDNA sequence of FGF-2 (SEQ ID NO.9):

[0045] CTGGTGGGTGTGGGGGGTGGAGATGTAGAAGATGTGACGCCGCGGCCCGGCGGGTGCC AGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGA GGCGGCTCTCCCCAGGCGGCGTCCGCGGAGACACCCATCCGTGAACCCCAGGTCCCGG GCCGCCGGCTCGCCGCGCACCAGGGGCCGGCGGACAGAAGAGCGGCCGAGCGGCTCG AGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCCGGGCGGGAGGCTGGGGGGCCGG GGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGGCCGGGGCCGGGGGACGGCG GCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCCGGCCGGGCCCCGCAGGGACCATGG CAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGGCGGCAGCGGCGCCTT CCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAACGGGGGCTTCTTC CTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCCGGGAGAAGAGCGACCCTCACA TCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGC TAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGA TGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAA ATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGA...

Embodiment 3

[0066] Molecular spatial structure docking of FGF-2 and anti-FGF-2 human ds-Diabody:

[0067] (1) Using ZDOCK to dock the molecular structure of FGF-2 and anti-FGF-2 human ds-Diabody

[0068] When the sampled Euler angle is 6°, the number of samples generated by the ZDOCK operation is 54,000 conformations, which makes the prediction result more accurate. ZRank was used to re-rank ZDOCK predicted conformations in terms of van der Waals forces, electrostatic potentials, and desolvation effects. The connecting peptide of the anti-FGF-2 human ds-Diabody is unlikely to appear at the interaction interface between the antigen and the antibody, and the amino acids constituting the connecting peptide are selected. The CDR region in the anti-FGF-2 human ds-Diabody must appear at the interaction interface between the antigen and the antibody, and the amino acids constituting the CDR region are selected. The docked conformation was analyzed with the help of plots and Dock and Analyze Pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-affinity anti-FGF-2 human-derived double-chain antibody with a stable disulfide bond and application. The human-derived double-chain antibody comprises a light-chain variable region shown as SEQ ID NO. 1 and a heavy-chain variable region shown as SEQ ID NO. 2. According to the high-affinity anti-FGF-2 human-derived double-chain antibody, a molecular structure is usedfor simulating a space structure of an antibody ds-Diabody and an antigen, and the stability is analyzed through thermodynamics; an antibody structure is optimized and modified to obtain the high-affinity anti-FGF-2 human-derived double-chain antibody with the stable disulfide bond; compared with an unmodified anti-FGF-2 human-derived ds-Diabody, the combination activity is improved by 3 times and the high-affinity anti-FGF-2 human-derived double-chain antibody with the stable disulfide bond has higher affinity; the antibody belongs to a small molecular antibody and has good tissue permeability; the disulfide bond is introduced so that the stability of the antibody can be improved; the antibody can be used for effectively inhibiting tumor angiogenesis and inhibiting the growth and transferring of tumors. Therefore, the human-derived double-chain antibody provided by the invention has a wide application prospect.

Description

technical field [0001] The invention belongs to the field of antibodies, in particular to a high-affinity anti-FGF-2 disulfide bond-stabilized human double-chain antibody and its application. Background technique [0002] FGF-2, called basic fibroblast growth factor, is a broad mitogen that can promote the proliferation, differentiation and anti-apoptosis of tumor cells and vascular endothelial cells through autocrine or paracrine methods. The high expression of FGF-2 in a variety of tumor tissues is closely related to the occurrence and development of tumors. At present, it has been reported that several strains of mouse-derived anti-FGF-2 monoclonal antibodies can significantly inhibit the growth of tumors. Coppola et al. reported that monoclonal antibodies against FGF-2 could inhibit FGF-2-induced tumor angiogenesis and the growth of chondrosarcoma in rats in vitro and in vivo. Taking FGF-2 as the target, blocking the FGF-2 / FGFR signaling pathway through antibodies, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/22C12N15/13A61K39/395A61P35/00A61P13/12A61P1/16A61P11/00G01N33/68G01N33/574
CPCC07K16/22C07K2317/24C07K2317/56C07K2317/565C07K2317/92C07K2317/94G01N33/574G01N33/68
Inventor 邓宁钟江川张思敏
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com