Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HLA related SNP marker and detection primer pair and determination method thereof

A technique for determining methods and labeling primers, applied in the medical field

Active Publication Date: 2018-04-10
广州博富瑞医学检验有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, there is no clinical report on the application of DQ promoter SNP analysis to organ transplantation. If the DQ promoter SNP can be analyzed to clarify the expression level of DQ protein in patients under immune status, it can be predicted by the patient's antigen presentation ability. The risk of humoral rejection after surgery, promote the status quo of early prediction of organ transplant rejection in my country, and guide the selection of donors in clinical practice, the dosage of immunosuppressants, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HLA related SNP marker and detection primer pair and determination method thereof
  • HLA related SNP marker and detection primer pair and determination method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 Obtaining a group of HLA-associated SNP markers

[0028] 1.1 Obtaining of blood samples in Example 1

[0029] Example 1 The blood samples were 6 blood samples randomly drawn from the pre-transplant whole blood samples of kidney transplant patients collected by the Organ Transplantation Department of the First Affiliated Hospital of Sun Yat-sen University for genomic DNA extraction.

[0030] 1.2 Example 1 Extraction of Genomic DNA from Blood Sample

[0031] In this experiment, TIANamp Blood DNA Kit (catalogue number: DP348) was used to extract genomic DNA from the blood sample of Example 1. The specific steps are as follows:

[0032] (1) Gently invert and mix the whole blood samples of the six patients in Example 1, and draw 200ul from it into a new 1.5ml EP tube (if the DNA extraction concentration is too low, you can also centrifuge the blood sample at 500g for 5min to separate the layers, and take The buffy coat cells in the middle are 200ul for subsequ...

Embodiment 2

[0061] The difference between this embodiment and embodiment 2 is that the primers used during amplification are different:

[0062] Upstream primer: 5'CTTTGAATTTAGGCAGAACG 3' (SEQ ID NO.3)

[0063] Downstream primer: 5'GCAGCATCACTTGTCTCC 3' (SEQ ID NO.4).

[0064] The nucleotide fragment where the SNP to be tested is located is amplified.

[0065] The PCR amplification product can be sequenced in the forward direction or in the reverse direction, preferably forward sequencing.

[0066] Forward sequencing primer 5'CTTTGAATTTAGGCAGAACG 3' (SEQ ID NO.3);

[0067] Reverse sequencing primer: 5'GCAGCATCACTTGTCTCC 3' (SEQ ID NO.4).

[0068] Since base 32610275 is one of the most important SNPs affecting the expression of DQ, the expression level of DQ is higher when the base at position 32610275 is T, and the expression level of DQ is lower when the base at position 32610275 is C. Based on the above principles, by measuring the SNP at the site above the DQ promoter of the patien...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an HLA related SNP marker and a detection primer pair and a determination method thereof, and aims to provide a primer and method for evaluating transplantation risk. An SNP marker related with HLA is disclosed and is the base C or T on 32610275th site of human No.6 chromosome. A primer pair for detecting the SNP marker described by the claim one has nucleotide sequences represented by SEQ ID No1-2 or SEQ ID No3-4. A method of determining the SNP site comprises following steps: (1) extracting genome DNA of a host cell; (2) subjecting the template DNA to PCR amplification, and purifying the PCR product (SAP / Exon I); and (3) subjecting the purified PCR product to forward and / or backward sequencing amplification by using a sequencing primer, purifying the sequencing product, and carrying out ABI 3730x1 capillary electrophoresis sequencing to determine the SNP site and genotype thereof.

Description

technical field [0001] The invention relates to the field of medical technology, in particular to an analysis of SNP markers related to HLADQ promoter, and the SNP markers are used to predict the rejection risk assessment of patients after organ transplantation. Background technique [0002] In the field of organ transplantation, various rejection reactions caused by humoral immunity mediated by HLA antibodies are the most critical factors affecting the survival of transplanted people / grafts. [0003] SNP (Single nucleotide polymorphism, single nucleotide polymorphism) mainly refers to the DNA sequence polymorphism caused by a single nucleotide variation at the genome level. [0004] In the human population, HLA (Human leukocyte antigen, human leukocyte antigen) has abundant polymorphisms. In organ transplantation, the HLA antigen in the endothelial cells of the donor organ is often used as the recognition antigen, causing a series of rejection reactions and affecting the or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/172
Inventor 余小林姚远何润钧
Owner 广州博富瑞医学检验有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com