Kit for analyzing intestinal microorganisms and application of kit
A gut microbiology and kit technology, applied in the field of molecular biology, can solve problems such as insufficient library coverage and low detection sensitivity, and achieve the effects of ensuring sequencing quality, improving coverage, and increasing complexity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1 Preparation of Detection Kit
[0079] (1) Preparation of primer composition
[0080] First set of primers:
[0081] The nucleic acid sequence of the first sequencing universal primer is shown in SEQ ID NO.1, the nucleic acid sequence of the second sequencing universal primer is shown in SEQ ID NO.2, and the nucleic acid sequence is as follows:
[0082] The first universal primer for sequencing (SEQ ID NO.1): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG;
[0083] Second sequencing universal primer (SEQ ID NO.2): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG;
[0084] The random base sequence is 1-7 random bases, such as (N) 1-7 , preferably 3-5 random bases, such as (N) 3-5 , where N represents any base in A\T\G\C;
[0085] The nucleotide sequence of the specific forward primer for the 16S rRNA V3-V4 region of the intestinal microorganism is shown in SEQ ID NO.3, and the nucleotide sequence of the specific reverse primer for the 16S rRNA V3-V4 region of the intestinal microorga...
Embodiment 2
[0102] Example 2 Extraction of sample DNA
[0103] Select 3 stool samples: A, B, and C, divide them into 2 parts on average, and mark them as: A1 / A2, B1 / B2, C1 / C2, and process the three samples of A1, B1, and C1 with the method described in this patent and obtain data , A2, B2, and C2 samples were directly sent to Genewise for sequencing. The specific DNA extraction method includes the following steps:
[0104] (1) Take 700-800μl of buffer A and 250mg of glass beads into a 2ml centrifuge tube;
[0105] (2) Add 250mg sample to the above 2ml centrifuge tube, vortex and mix for 10s;
[0106] (3) Add 70 μl of lysate B to the sample, vortex for 7 minutes to mix the sample, and centrifuge at 12,000 rpm (~13,400×g) for 60 s. Transfer the supernatant (500 μl) to a new 2ml centrifuge tube;
[0107] (4) Add 250 μl of suspension C, vortex for 10 seconds, place at room temperature for 2 minutes, centrifuge at 12,000 rpm (~13,400×g) for 60 seconds, and precipitate the sample particles; ...
Embodiment 3
[0117] Example 3 Library construction
[0118] (1) Prepare the following reaction solution on ice, except DNA extraction solution and H 2 Other than O, according to the following components, first prepare the amplification premix Mix according to the amount of reaction number + α, and take the prepared premix Mix and distribute it into PCR reaction tubes. The specific primer sequences are as follows:
[0119] Upstream primer (SEQ ID NO.29): 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-ATGCA-CCTACGGA GTGCAGCAGTAGCGAAT-3';
[0120] Downstream primer (SEQ ID NO.30): 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-TCAGA-GGACTAC ACGGGTATCTAATC-3';
[0121] The reaction system is as follows:
[0122]
[0123] Set up a set of negative controls with water as the sample.
[0124] The reaction conditions are as follows:
[0125]
[0126] (2) Purification of the first round of PCR products
[0127] Use Agencourt AMPure XP (Beckman Coulter company) to purify the first-round PCR amplification pro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More