Supercharge Your Innovation With Domain-Expert AI Agents!

Application of a lncrna in diagnosis and/or treatment of lung adenocarcinoma

A technique of lung adenocarcinoma cells and uses, applied in the field of molecular biology

Active Publication Date: 2020-04-03
WEIFANG MEDICAL UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on lncRNA is just in its infancy, and there is still a big gap in this field that researchers need to fill.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a lncrna in diagnosis and/or treatment of lung adenocarcinoma
  • Application of a lncrna in diagnosis and/or treatment of lung adenocarcinoma
  • Application of a lncrna in diagnosis and/or treatment of lung adenocarcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] (1) Total RNA in cells was extracted with Trizol from Invitrogen.

[0034] (1) Aspirate the culture medium of the cells to be tested in the 6-well plate, add 1ml Trizol to the cells to cover the cultured cells, then pipette 2-3 times with a pipette or pipette, the cells should be completely lysed, and then transfer to a centrifuge tube middle.

[0035] (2) Add 0.2 times the volume of chloroform (0.2 mL chloroform to 1 mL Trizol) into the centrifuge tube containing the lysate, shake and mix thoroughly on the shaker for 30 seconds, and place at room temperature for 2-3 minutes. Centrifuge at 12,000g at 4°C for 10 minutes, then pipette the upper aqueous phase containing total RNA into a new centrifuge tube, about 0.5-0.6mL per mL of Trizol. The organic phase and interlayer contain DNA and proteins and should be avoided.

[0036] (3) Add 0.5mL of isopropanol for every mL of Trizol, mix by inverting several times, and precipitate at room temperature for 10 minutes. Centri...

Embodiment 2

[0047] Lung adenocarcinoma cells H1299 were infected with shRNA lentivirus to knock out lncRNA-AC009948.5 in the cells, and a cell line stably expressing shRNA was screened out. The H1299 cells infected with RNAi lentivirus were called SiAC009948.5 / H1299, and the infection control Lentiviral H1299 cells are called Scr / H1299.

[0048] The lncRNA-AC009948.5shRNA lentivirus was customized by Shanghai Jikai Gene Company, and the carrier name is GV248. The shRNA sequence is TACCTTGCCTCATTGAGTAAT, as shown in SEQ ID NO.4.

[0049] The screening method for the cell strains stably expressing shRNA is as follows: infect the cells overnight with the shRNA lentivirus, then replace the fresh medium, and after culturing for 48-72 hours, observe the proportion of GFP positive cells to determine the virus infection efficiency; After 72 hours, 2 μg / mL puromycin was added for selection; the cells with a GFP positive rate above 90% or after puromycin selection can be regarded as cell lines wit...

Embodiment 3

[0051] The migration ability of cells was detected by wound healing experiment. Experimental steps: Spread SiAC009948.5 / H1299 cells and Scr / H1299 cells in a 35mm culture dish. After two days of growth, remove the conventional culture medium and replace it with 1% fetal bovine serum culture medium. Use a 10 μL pipette tip to draw a uniform scratch on the bottom of the petri dish, and randomly select three fixed positions under an optical microscope to record the width of the scratch. The change of cell migration ability was judged according to the change of scratch width. The experiment was repeated three times, and the area of ​​the cell scratch was counted by ImageJ. Experimental results such as image 3 As mentioned above, knocking out lncRNA-AC009948.5 can significantly inhibit the migration ability of H1299 cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a lncRNA lung adenocarcinoma marker and application of knockout of the lncRNA lung adenocarcinoma marker in treating lung adenocarcinoma. The lncRNA is AC009948.5, the nucleotide sequence of the lncRNA is as shown in the SEQ ID NO.1, and the marker is significantly up-regulated in lung adenocarcinoma cells and canbe used for assisting screening of the lung adenocarcinoma. In addition, it is discovered that by means of the knockout of the lncRNA, invasion, metastasis and proliferation of the lung adenocarcinoma cells can be effectively inhibited, which can be used for treating the lung adenocarcinoma.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to the application of a lncRNA in the diagnosis and / or treatment of lung adenocarcinoma. Background technique [0002] Lung cancer is the leading cause of death worldwide. Currently in China, the incidence of lung cancer is increasing year by year. Lung cancer can be divided into small cell lung cancer and non-small cell lung cancer (NSCLC) according to different clinicopathological types. Among them, non-small cell lung cancer is the most common in lung cancer, accounting for about 85% of lung cancer, and lung adenocarcinoma is the most important part. For non-small cell lung cancer, surgical treatment is still the first choice for clinical treatment, and for early non-small cell lung cancer patients (stage I and II, and ideally stage IIIA patients), radical resection of lung cancer is still the primary treatment method. According to relevant literature reports, the postoperativ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886A61K31/7088A61P35/00
CPCA61K31/7088C12Q1/6886C12Q2600/158C12Q2600/178
Inventor 李洪利尹崇高盖利张增山
Owner WEIFANG MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More