Dead SaCas9-Fok1 system, as well as construction method and application thereof

A deadsacas9-fok1 and construction method technology, applied in the field of gene editing systems, can solve the problems of reducing off-target efficiency, large distance tolerance, short recognition sequence, etc., and achieve the effects of improving targeting efficiency, reducing off-target efficiency, and small molecular weight

Inactive Publication Date: 2018-06-12
广东赤萌医疗科技有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

2. The sgRNA sequence is only about 20 nt, although it makes it easy for us to select the target site in the genome (for the same length of DNA sequence, compared with ZFN and TALEN technology, CRISPR is easier to select the target site), but The recognition sequence of about 20nt is relatively short, and similar sequences are easy to appear in the genome
[0005] However, the above existing technologies still have the following disadvantages: (1) Although the SaCas9 and NmCas9 systems have long PAM and sgRNA sequences and low off-target frequency, the degree of improvement is not large enough to meet the requirements of clinical application. , the probability of the target sequence appearing in the genome decreases, which makes it difficult to select the target site
(2) Nickase systems are currently commonly used as SpNickase and SaNickase. Although the off-target efficiency has decreased significantly, due to the independent single-strand cleavage activity of Nickase enzyme, it can independently cut the target site, and there may still be unexpected effects. Off-target mutations, and the Nickase system is more tolerant to the distance between the two gRNA target sequences. The study found that the distance between the two target sequences is about 200bp, and DSBs can still be generated. In addition, Cas9 is tolerant to the mismatch between the sgRNA and the target sequence , so that the off-target efficiency of the Nickase system still cannot meet the clinical needs
In addition, since the nicks formed by the Nickase system for cleavage of the sense strand and the antisense strand are generally staggered (that is, DBS with sticky ends are formed), the nicks are easily repaired by cells separately, resulting in a decrease in the probability of producing DBS, that is, cutting efficiency reduce
(3) The dead Cas9 fusion Fok1 system is currently generally believed to be a CRISPR system with the lowest off-target efficiency. It mainly reduces the off-target efficiency by two sgRNA recognition sites and limiting the distance between the two recognition sites. However, only dead SpCas9 has been constructed so far. -Fok1 system, which is transformed from SpCas9, the specific working principle is as follows image 3 shown
However, the large molecular weight of SpCas9 may hinder the combination of two Fok1 monomers in terms of spatial structure, thereby reducing the cutting efficiency. In addition, for viral delivery vectors, such a large molecule is difficult to be packaged and transported, thus limiting this application of the technology, especially limiting its application to in vivo gene editing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dead SaCas9-Fok1 system, as well as construction method and application thereof
  • Dead SaCas9-Fok1 system, as well as construction method and application thereof
  • Dead SaCas9-Fok1 system, as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Obtaining of U6-sgRNA expression cassette and construction of U6-sgRNA expression vector

[0042] 1. Synthesis of target fragments

[0043] (1) Synthesize the U6-sgRNA fragment, which is inserted into the Sma I site of the pUC19 vector, wherein the U6-sgRNA fragment is shown in SEQ ID NO: 6, using pUC19-U6-sgRNA as a template, using the primer SaCas9-U6- L / SaCas9-gRNA-R, PCR amplification of the target fragment U6-sgRNA;

[0044] SaCas9-U6-L: 5'-GTACGGGCCAGATATACGCGT-3' (SEQ ID NO: 7)

[0045] SaCas9-gRNA-R: 5′-CAATAATCAATGTCAACGCGT-3′ (SEQ ID NO: 8)

[0046] (2) Purify the above PCR product with a DNA purification kit.

[0047] 2. Expression vector preparation

[0048] (1) The commercial vector pSaCas9-GFP (plasmid map as shown in Figure 6 Shown) Escherichia coli expanded culture, extract plasmid pSaCas9-GFP;

[0049] (2) Digest pSaCas9-GFP plasmid with restriction endonuclease Mlu I-HF, digest at 37°C for 1 hour, and inactivate the enzyme at 65°C for ...

Embodiment 2

[0058] Example 2 Obtaining of dead SaCas9 gene and construction of dead SaCas9 expression vector

[0059] (1) Transformation of pSaCas9nD10A

[0060] 1. Synthesis of target fragments

[0061] (1) Outsourced synthesis of the SaCas9nD10A mutant fragment, which was inserted into the Sma I site of the pUC19 vector;

[0062] The sequence of the SaCas9nD10A mutant fragment is shown in SEQ ID NO: 9;

[0063] (2) Using pUC19-SaCas9nD10A as a template, using primers SaD10A-L / SaD10A-R, PCR amplifies the target fragment SaCas9nD10A;

[0064]SaD10A-L: 5'-CATCATTTTGGCAAAGAATTC-3' (SEQ ID NO: 10)

[0065] SaD10A-R: 5'-GACAGCTTCTGACTCAGGCCT-3' (SEQ ID NO: 11)

[0066] (3) Purify the above PCR product with a DNA purification kit.

[0067] 2. Expression vector preparation

[0068] (1) The pSaCas9-gRNA plasmid obtained in Example 1 was double digested with restriction endonucleases EcoR I and Stu I, digested at 37°C for 1 hour, and inactivated at 65°C for 20 minutes;

[0069] (2) After t...

Embodiment 3

[0095] Example 3 Obtaining of Fok1 gene and construction of dead SaCas9-Fok1 expression vector

[0096] 1. Synthesis of target fragments

[0097] (1) Outsourced synthesis of the Linker-Fok1 fragment, which was inserted into the Sma I site of the pUC19 vector;

[0098] The Linker-Fok1 fragment sequence is shown in SEQ ID NO: 15;

[0099] (2) Using pUC19-Linker-Fok1 as a template, use primers Fok I-EcoN I-L / Fok I-Pst I-R to amplify the target fragment Linker-Fok1 by PCR;

[0100] FokI-EcoNI-L: cgacattctg ggaaacctgt atgaggtgaa gagcaaaaag cac (SEQ ID NO: 16)

[0101] FokI-PstI-R: catgagatccccgcgctgcagttaaaagtttatctcacc (SEQ ID NO: 17);

[0102] (3) Purify the above PCR product with a DNA purification kit.

[0103] 2. Expression vector preparation

[0104] (1) The p-dead SaCas9 plasmid obtained in Example 2 (2) was double-digested with restriction endonucleases EcoN I and Pst I, and after digestion at 37°C for 1 hour, the enzyme was inactivated at 65°C for 20 minutes;

[0105...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dead SaCas9-Fok1 system, as well as a construction method and application thereof. Due to the fact that the molecular weight of SaCas9 is small, p-dead SaCas9-Fok1 recombinant plasmids use dead SaCas9 to replace traditional dead SpCas9, and the influence of SpCas9 steric hindrance on mutual combination of Fok1 is reduced, so that the targeting efficiency is improved; thedead SaCas9-Fok1 system needs the combined action of Sa-sgRNA in cooperation with 2 21nt, the Sa-sgRNA is longer than Sp-sgRNA(20nt), and the PAM sequence recognized by the SaCas9 is 6nt and longer than PAM(3nt) of SpCas9, so that when the dead SaCas9-Fok1 is matched with two Sa-sg RNAs for use, the off-targeting efficiency is further reduced.

Description

technical field [0001] The present invention relates to a gene editing system, especially a dead SaCas9-Fok1 system and its construction method and application. Background technique [0002] CRISPR gene editing technology has been widely used in research and production, and is currently recognized as the third generation of gene editing technology (first generation, ZFN; second generation, TALEN; third generation, CRISPR). Compared with ZFN, TALEN and other technologies, CRISPR has obvious advantages, such as simple construction, high efficiency and low cost of use. According to different bacterial sources, different types of CRISPR enzyme systems have been developed, such as SpCas9, SaCas9, NmCas9 and StCas9 systems, etc., but all CRISPR systems include the following parts, such as figure 1 Shown: 1) PAM site, located downstream of the target sequence, only a few nt (for example, SpCas9 / NGG; SaCas9 / NNGRRT), select the target sequence according to this site; 2) sgRNA, recog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N9/22A61K31/7105A61K48/00A61P31/18
CPCA61K31/7105A61K48/0008C12N9/22C12N15/907
Inventor黄雨亭祝海宝罗思施陶米林梁福才刘方方唐忆琳
Owner广东赤萌医疗科技有限公司