An optimized method for identifying the vigs silencing system of rose rhpds gene
A rose and gene technology, applied in the field of VIGS silencing system for identifying RhPDS gene of rose, can solve the problems of application, difficult VIGS technology, long plant growth cycle, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The technical solutions of the present invention will be further described below through specific examples.
[0033] 1. Materials and methods
[0034] 1.1. Materials
[0035] The selected rose variety was 'karina'; the potted plants were maintained routinely in the greenhouse until they had four compound leaves; Rooted tissue culture seedlings growing normally in the tissue culture experiment center of the college. Commercially available pTRV1 and pTRV2 vectors were purchased.
[0036] 1.2 Vector construction
[0037] 1.2.1 Amplification of the RhPDS gene sheet with restriction sites
[0038] The total RNA in rose leaves was extracted with a polysaccharide polyphenol RNA rapid extraction kit, and then reverse-transcribed into cDNA with a cDNA reverse kit. Use the RhPDS gene as a template to design primers, and introduce EcoR I and BamH I restriction site sequences when designing primers.
[0039] Primer 1: PDS-F1: CGCGGATCCCTCCCACAGGCTTAGTGAAAA; (Sequence Listing ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com