Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An optimized method for identifying the vigs silencing system of rose rhpds gene

A rose and gene technology, applied in the field of VIGS silencing system for identifying RhPDS gene of rose, can solve the problems of application, difficult VIGS technology, long plant growth cycle, etc.

Active Publication Date: 2020-12-11
BEIJING UNIV OF AGRI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the characteristics of the physiological structure of woody plants, the plant growth cycle is long, which makes it difficult to apply VIGS technology to woody plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An optimized method for identifying the vigs silencing system of rose rhpds gene
  • An optimized method for identifying the vigs silencing system of rose rhpds gene
  • An optimized method for identifying the vigs silencing system of rose rhpds gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The technical solutions of the present invention will be further described below through specific examples.

[0033] 1. Materials and methods

[0034] 1.1. Materials

[0035] The selected rose variety was 'karina'; the potted plants were maintained routinely in the greenhouse until they had four compound leaves; Rooted tissue culture seedlings growing normally in the tissue culture experiment center of the college. Commercially available pTRV1 and pTRV2 vectors were purchased.

[0036] 1.2 Vector construction

[0037] 1.2.1 Amplification of the RhPDS gene sheet with restriction sites

[0038] The total RNA in rose leaves was extracted with a polysaccharide polyphenol RNA rapid extraction kit, and then reverse-transcribed into cDNA with a cDNA reverse kit. Use the RhPDS gene as a template to design primers, and introduce EcoR I and BamH I restriction site sequences when designing primers.

[0039] Primer 1: PDS-F1: CGCGGATCCCTCCCACAGGCTTAGTGAAAA; (Sequence Listing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an optimized method for a VIGS (virus-induced gene silencing) system identifying rose RhPDS gene. The method includes the steps of: 1) constructing a recombinant virus plasmid pTRV2-RhPDS; 2) preparing an infection liquid; 3) infecting Chinese rose plants, and Chinese rose cutting seedlings and rooted Chinese rose tissue culture seedlings respectively by high pressure spraygun method and vacuum infiltration method, and then detecting gene silencing efficiency; and 4) conducting analysis and comparison from the three aspects of quantity efficiency of silent plants, the albino time of plants and the relative expression of RhPDS gene, thus obtaining an optimum scheme of the VIGS system. The method provided by the invention improves the application efficiency of the VIGS technical system in Chinese rose, and lays the foundation for large-scale application of the VIGS technical system in Chinese rose.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to an optimized VIGS silencing system method for identifying the rose RhPDS gene. Background technique [0002] Virus-induced gene silencing (VIGS) refers to a virus carrying the cDNA of a plant target gene, which can induce specific degradation of the mRNA of an endogenous gene after infecting a plant, so that the gene is transcribed If the gene is silenced, the corresponding phenotype will be mutated, so that the function of the gene can be reflected by the changes in the plant phenotype or physiological indicators. Compared with traditional genetic transformation methods, VIGS technology is a method that eliminates the need for large-scale screening of mutants, can complete the verification of target genes in contemporary times, is simple to operate, and is suitable for functional analysis of plant genes. It has become an attractive field of functional genomics resear...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/83C12N15/66C12N15/53C12Q1/6895
CPCC12N9/001C12N15/66C12N15/8218C12N15/825C12Q1/6895C12Q2600/13C12Y103/99029
Inventor 崔金腾张克中赵和文丁榕梁晶
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com