Unlock instant, AI-driven research and patent intelligence for your innovation.

Establishing method of neutropenia atherosclerosis model rat

A technology of atherosclerosis and neutrophils, applied in the field of genetic engineering and genetic modification, to achieve the effect of alleviating the symptoms of atherosclerosis

Active Publication Date: 2018-07-13
XINXIANG MEDICAL UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, when studying whether neutrophils are needed in the formation of atherosclerosis, and whether neutrophils participate in the repair of atherosclerosis, there is no suitable animal model to use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishing method of neutropenia atherosclerosis model rat
  • Establishing method of neutropenia atherosclerosis model rat
  • Establishing method of neutropenia atherosclerosis model rat

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The establishment method of the neutrophil-deficient atherosclerosis model mouse in this embodiment comprises the following steps:

[0037] 1) Gfi1 point mutant mice (genotype Gfi1 C318Y / C318Y ) and ApoE knockout mice (genotype ApoE - / - ) were crossed to obtain F1 generation mice, which were heterozygous for both gene loci (genotype is ApoE + / - Gfi1 + / C318Y ).

[0038] 2) F1 generation mice were self-crossed with both gene loci heterozygous to obtain F2 generation mice.

[0039] A. By using sanger sequencing, mice that are heterozygous and homozygous for the Gfi1 point mutation can be selected. The detection primer sequence is: Gfi1-f: GGAGCTACGCTTTTGTCCTG (as shown in SEQ ID NO.1), Gfi1-r: CCTGTGTGGATGAAGGTGTG (As shown in SEQ ID NO.2), the size of the amplified product is 429bp.

[0040] The PCR system is: (Vazyme, P111) 2*Taq Master PCR MIX: 10 μL, 0.5 μL each of Gfi1-F (5 μM) and Gfi1-R (5 μM); genomic DNA: 10 ng; supplemented with ddH 2 0 to a total volume of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an establishing method of a neutropenia atherosclerosis model rat, and belongs to the technical field of genetic engineering and genetic modification. A first neutropenia atherosclerosis rat genetic model is established by introducing the Gfi1 point mutation into an ApoE-knocked-out rat gemone for the first time. It is proved through experiments that in the model rat, atherosclerosis plaque is remarkably reduced and atherosclerosis symptoms are remarkably relieved; it is shown that the neutropenia atherosclerosis model rat is successfully established and the atherosclerosis lesion degree can be relieved by neutropenia. The obtained neutropenia cocurrent atherosclerosis model rat has quite important potential application value in the disclosing of the effects of neutrophils on forming and repairing of atherosclerosis and in the diagnosis and treatment of atherosclerosis.

Description

technical field [0001] The invention relates to a method for establishing a neutrophil-deficient atherosclerosis model mouse, and belongs to the technical field of genetic engineering and genetic modification. Background technique [0002] Cardiovascular and cerebrovascular diseases have become the diseases that cause the largest number of deaths in the world due to the difficulty in curing and high mortality. Atherosclerosis is one of the main causes of cardiovascular and cerebrovascular diseases. Its pathogenic factors are complex and seriously harmful to health. , so it is necessary to further study its mechanism. Atherosclerosis (AS) is the main cause of coronary heart disease, cerebral infarction, and peripheral vascular disease, but there is a lack of suitable animal models for studying its pathogenesis and clinical treatment. [0003] Neutrophils (Neutrophil, or Neutrophil granulocytes) are one of the blood cell components in the blood, with chemotaxis, phagocytosis ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01K67/027C12Q1/6888
CPCA01K67/0276A01K2207/12A01K2217/075A01K2227/105A01K2267/0375C12Q1/6888C12Q2600/156
Inventor 梁银明张黎琛卢燎勋黄蓉晁天柱郑前前罗静谷妍蓉
Owner XINXIANG MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More