Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Overexpressed COX5A transgenic mouse model as well as construction method and application thereof

A construction method and technology of transgenic mice, applied in the field of COX5A overexpression transgenic mouse model and its construction, can solve the problems such as unclear mechanism of mitochondrial defects

Active Publication Date: 2018-08-14
KUNMING MEDICAL UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, the mechanism of mitochondrial defects in the pathogenesis of AD is still unclear, and the role of COX5A in brain aging and aging-related diseases and the related signaling pathways involved have not yet been elucidated and have not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpressed COX5A transgenic mouse model as well as construction method and application thereof
  • Overexpressed COX5A transgenic mouse model as well as construction method and application thereof
  • Overexpressed COX5A transgenic mouse model as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Construction of overexpressed COX5A transgenic mouse model:

[0051] The construction method includes the following steps:

[0052] Step 1, PCR cloning and amplification of the open reading frame (ORF) of the target gene COX5A (GeneID: 12858), the amplification primer sequences are as follows:

[0053] The upstream primer is 5'GTCAATGGGTGGAGTATTTACG 3', the nucleotide sequence of which is shown in SEQ ID NO.1;

[0054] The downstream primer is 5'GCTTATATAGACCTCCCCACCGT 3', the nucleotide sequence of which is shown in SEQ ID NO.2; the target fragment is 386bp.

[0055] Step 2, pcDNA3.1(+)-m-COX5A plasmid construction. After digestion, recovery of DNA fragments, and ligation reaction, restriction enzymes EcoRI and XhoI were used to digest the pcDNA3.1(+ / -) Vector vector and the ORF of the inserted target fragment COX5A. Such as figure 1 shown in a-b.

[0056] Step 3, transfer the constructed plasmid vector into strains to extract DNA, prepare plasmid DNA in...

Embodiment 2

[0071] Example 2 Construction of a low-expression BDNF transgenic mouse model:

[0072] Include the following experimental steps:

[0073] Step 1. Construction of CMV-EmGFP-siRNA-BDNF low-expression transgene fragment: the silent expression vector CMV-EmGFP-siRNA-BDNF was purchased from Invitrogen, and the target gene BDNF[BDNF brain derived neurotrophic factor( Mus musculus), GeneID: 12064], the target site is (CCAAGTGTAATCCCATGGGTT), a silent plasmid was designed, and then the plasmid construction was completed by Zhongmeitaihe Company.

[0074] Step 2. The constructed silencing plasmid is transfected into 293T cells, and then the RT-PCR method is used to screen out the construction with a good silencing effect, such as image 3 As shown, compared with the control group and the other three interfering plasmids, the expression of BDNF in the cells transfected with the BDNF low-expression transgenic plasmid No. 47 was significantly reduced, which was reserved for subsequent u...

Embodiment 3

[0086] Example 3 Construction of Overexpression COX5A / Low Expression BDNF Transgenic Mouse Model (COX5A-UP / BDNF-DO)

[0087] The COX5A overexpression line Founder 35 and the BDNF low expression line Founder 39F1 generation were caged together, and COX5A overexpression and BDNF low expression double hybrid mice were obtained from the progeny mice. Generation of mice, genotype detection of offspring mice, PCR method detects COX5A overexpression transgenic mouse genotype and BDNF low expression transgenic mouse genotype fragments in mouse tail genomic DNA at the same time, that is, mice with overexpression of COX5A and low expression of COX5A Two-hybrid mice expressing BDNF.

[0088] Depend on Figure 6 It can be seen that the above two fragments were detected simultaneously in the tail DNA of the transgenic mice, indicating that the double-hybrid mice with overexpression of COX5A and low expression of BDNF were successfully constructed.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an overexpressed COX5A transgenic mouse model as well as a construction method and application thereof. The construction method comprises the following steps: carrying out PCR(Polymerase Chain Reaction) cloning and amplification on an open reading frame of a target gene COX5A; constructing pcDNA3.1(+)-m-COX5A plasmids; transferring a constructed plasmid vector into a strain and extracting DNA (Deoxyribonucleic Acid); recycling DNA segments; purifying the DNA and dissolving and recycling the DNA; diluting a DNA sample by utilizing a TE microinjection diluting solution;linearizing a constructed transgenic gene segment and producing a transgenic mouse by utilizing a microinjection method; identifying a positive transgenic mouse by utilizing a PCR method; screening the strain with the highest COX5A expression level and establishing the stable COX5A overexpressed mouse model. According to the construction method disclosed by the invention, the overexpressed COX5A transgenic mouse model is obtained for the first time and a new strategy is provided for preparing a medicine for preventing or treating brain ageing and ageing related diseases.

Description

technical field [0001] The invention belongs to the technical field of animal models, and in particular relates to a COX5A overexpression transgenic mouse model and its construction method and application. Background technique [0002] Brain aging is an adaptive and irreversible change that the body makes to adapt to the aging state that aggravates with age. This process usually leads to the decline of learning ability and the loss of part of memory. Brain aging develops in a malignant direction to a certain stage and may evolve into some common and difficult diseases, such as Alzheimer's disease (AD), Parkinson's syndrome (PD) and a series of other aging-related clinical diseases. This situation has also attracted the attention of more and more countries and social institutions, and invested a lot of manpower, financial resources, and material resources to carry out a lot of research work in related fields of neuroscience. The past 1990-1999 was hailed by the U.S. governme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/89A01K67/027A61K49/00
CPCA01K67/0275A01K2227/105A01K2267/03A61K49/0008C12N9/0053C12N15/8509C12N15/89C12Y109/03001
Inventor 习杨彦彬金华陈波张丽王廷华张连峰
Owner KUNMING MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products