Quality detecting method of Dendrobium aphyllum

A quality inspection method, the technology of Dendrobium nobile candidum, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems that cannot fully reflect the overall curative effect, achieve pertinence and applicability of interpretation, realize correlation analysis, and effectively identify and the effect of quality control

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detecting method of Dendrobium aphyllum
  • Quality detecting method of Dendrobium aphyllum
  • Quality detecting method of Dendrobium aphyllum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The first generation sequencing of embodiment 1 dendrobium nobile

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0057] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium.

Embodiment 2

[0058] The extraction method of embodiment 2 dendrobium nobile

[0059] Take the dry sample of Dendrobium dendrobii, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml Erlenmeyer flask, add 50mL 75 % methanol (V water: V methanol = 25:75), take it out after ultrasonication for 30 minutes at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve it with 75% methanol solvent (V water: V methanol = 25:75), and finally transfer Dilute to a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium dendrobii.

Embodiment 3

[0060] The chromatographic detection method of embodiment 3 dendrobium nobile extract

[0061] ①Preparation of reference solution

[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for the determination of small molecular components of Dendrobium nobile:

[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volumetric flas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses a quality detecting method of Dendrobium aphyllum. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of ato-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and/or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium aphyllum; and 4) establishing an analysis model by using the content value of the schaftoside and/or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint asthe independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium aphyllum is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of components of traditional Chinese medicines, and in particular relates to a quality detection method of dendrobium dendrobii. Background technique [0002] Dendrobium aphyllum (Roxb.) C. Fischer (scientific name: Dendrobium aphyllum (Roxb.) C. Fischer): also known as Dendrobium aphyllum. Stems drooping, fleshy, thin cylindrical, 30cm-60cm long, 0.4cm-0.7cm in diameter, unbranched, multi-noded, internodes 2cm-3.5cm long; leaf bases with sheaths, leaf sheaths papery, pale white after drying , the mouth of the sheath opens cup-shaped. Racemes almost without inflorescence rachis, each 1-3 as a bunch, issued from the upper part of the old stem with leaves or the old stem with leaves; the inflorescence peduncle is about 0.2cm-0.5cm long, and the base is covered by 3-4 sheaths The sheath is membranous, 0.2cm-0.3cm long; the bracts are light white, membranous, ovate, about 0.3cm long, with sharp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N30/06G01N30/86
CPCG01N30/06G01N30/8686
Inventor 赵田邵自星
Owner 北京蓝标一成科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap