Supercharge Your Innovation With Domain-Expert AI Agents!

Quality detection method of Dendrobium denneanum Kerr

A quality inspection method and technology of Dendrobium candidum, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, effectively identify and control quality, and achieve The effect of correlation analysis

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium denneanum Kerr
  • Quality detection method of Dendrobium denneanum Kerr
  • Quality detection method of Dendrobium denneanum Kerr

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Generation sequencing of Dendrobium sheath

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0057] Through the first generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium sheathing.

Embodiment 2

[0058] The extraction method of embodiment 2 dendrobium sheath

[0059] Take the dried sample of Dendrobium sheathing, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, add 50mL 75 % methanol (V water: V methanol = 25:75), take it out after ultrasonication for 30 minutes at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve it with 75% methanol solvent (V water: V methanol = 25:75), and finally transfer Dilute it to a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium sheathing.

Embodiment 3

[0060] Example 3 Chromatographic detection method of Dendrobium sheath extract

[0061] ①Preparation of reference solution

[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for determination of small molecule components of Dendrobium sheathing:

[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volumetric flask, add 50...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium denneanum Kerr. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the varietyof a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium denneanum Kerr; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. Accordingto the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium denneanum Kerr is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine components, and in particular relates to a quality detection method of dendrobium sheaths. Background technique [0002] Dendrobium dendrobium (scientific name: Dendrobium denneanum Kerr): stems are slender, cylindrical, 25cm-35cm long, 0.4cm-0.7cm in diameter, unbranched, multi-noded, internodes 2.5cm-4cm long, often light yellow when dry or tan. Leaf bases with clasping sheaths. The raceme is laterally born on the upper end of the biennial deciduous old stem, about 1cm long, usually with 2-7 flowers sparsely; the inflorescence peduncle is nearly erect, about 0.5cm long, with 3-4 sheaths at the base; the sheath is papery , light white, cup-shaped or tubular, with a short sheath at the base, gradually becoming longer upwards, 0.5cm-2.0cm long; membranous bracts, light white, boat-shaped, about 1.2cm long, about 0.5cm wide, with blunt apex ; pedicel and ovary...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N30/06G01N30/74G01N30/86
CPCG01N30/06G01N30/74G01N30/8686
Inventor 赵田邵自星
Owner 北京蓝标一成科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More