Calibration product for fragile X syndrome virulence gene detection and application thereof

A disease-causing gene and calibrator technology, which is applied in the field of calibrator for the detection of fragile X syndrome pathogenic genes, can solve the problems of insufficient resolution, long detection time, errors, etc., and achieve improved resolution, perfect and accurate detection methods Effect

Inactive Publication Date: 2018-09-18
GUANGZHOU DARUI BIOTECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But these also have certain defects, such as high difficulty in operation, long detection time, high cost, etc.
In addition, the resolution of the CGG repeat number of the FMR1 gene is still not enough
Based on the target fragment of the FMR1 gene amplified by PCR technology, the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Calibration product for fragile X syndrome virulence gene detection and application thereof
  • Calibration product for fragile X syndrome virulence gene detection and application thereof
  • Calibration product for fragile X syndrome virulence gene detection and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Preparation of Fragile X Syndrome Causative FMR1 Gene Detection Calibrator

[0027] 1. Raw materials

[0028] Four kinds of fragile X syndrome cell lines (GM06905 repeat number 23 / 77, GM20232 repeat number 46, GM20233 repeat number 117, GM20236 repeat number 31 / 53) were purchased from Coriell Institute for Medical Research and prepared as fragile X syndrome gene detection calibrator raw materials. The above cell lines were cultured according to the instructions.

[0029] 2. Genomic DNA extraction

[0030] The cultured cells were extracted using the Genomic DNA Extraction Kit from QIAGEN, and the DNA concentration was measured using Qubit 3.0.

[0031] 3. Preparation of calibrator

[0032] According to the concentration measured in step 2, 10 μg of genomic DNA from each cell line was mixed to obtain the required calibrator.

Embodiment 2

[0033] Example 2 Detection of Fragile X Syndrome Gene Detection Calibrator

[0034] 1, use the calibrator that embodiment 1 makes, carry out PCR reaction according to following system and condition:

[0035] PCR reaction system: Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube. The PCR amplification system is as follows:

[0036]

[0037]

[0038] Among them, the primers involved are shown in Table 1 below:

[0039] Table 1 Primer Sequence

[0040] Upstream primer F sequence

FAM-TCAGGCGCTCAGCTCCGTTTCGGTTTCA (SEQ ID NO. 1)

downstream primer R sequence

AAGCGCCATTGGAGCCCCGCACTTCC (SEQ ID NO. 2)

[0041] Composition of PCR enhancer: 4 μL of betaine (5 mol / L), 1.2 μL of DMSO.

[0042] PCR reaction program: 98°C pre-denaturation for 10 min, followed by 33 cycles: denaturation at 97°C for 35 s, annealing at 62°C for 35 s, extension at 68°C for 4 min, and final extension at 68°C for 10 min.

[0043] 2. Detection of PCR amplifi...

Embodiment 3

[0047] Example 3 Application of Calibrator in Detection of Fragile X Syndrome Related Gene FMR1

[0048] 1. Sample collection: Collect peripheral blood samples from 4 patients with known Fragile X Syndrome, and use QIAGEN's Genomic DNA Extraction Kit to extract.

[0049] 2. According to the detection method of Example 2, the calibrator and 4 samples were detected, and the standard curve formula y=0.3396x-78.742 (R 2 =0.9999), the detection peak diagram is as follows Figure 3-6 As shown, the results are shown in Table 2 below, and the type is consistent with the original type.

[0050] The number of CGG repeats of the samples in Table 2

[0051]

[0052]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a calibration product for fragile X syndrome virulence gene detection and application thereof. The calibration product contains at least six FMR1 gene fragments with differentCGG sequence repeating numbers. When the calibration product for fragile X syndrome virulence gene detection is used, a fluorescence PCR-capillary electrophoresis method is used for detecting the FMR1gene CGG repeating number; the calibration product and the detection result are used for building a standard curve, so that the CGG repeated number of the detection sample in the same batch can be calculated. The method obviously improves the resolution of the fragile X syndrome virulence gene detection, so that the detection method of the fragile X syndrome is more complete and accurate.

Description

technical field [0001] The invention relates to the technical field of fragile X syndrome gene detection, in particular to a calibrator for the detection of fragile X syndrome pathogenic genes and its application. Background technique [0002] Fragile X syndrome is the most common type of hereditary mental retardation next to congenital mental retardation, with an incidence rate of 1 / 2500-1 / 5000, and the incidence rate is about 6.3% among mentally retarded patients in my country. There are obvious gender differences in the incidence of this disease, and the incidence rate of males is higher. According to statistics, the incidence rate of males is 1:4000, and the incidence rate of females is 1:8000-1:6000. Its main feature is moderate to severe mental retardation, which tends to worsen with age. Other clinical manifestations are special facial features, such as long face or protruding ears, large testicles appear after puberty, and many patients also show impulsiveness and hy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156C12Q2600/166
Inventor 吴英松李明杨学习杨旭王文玉
Owner GUANGZHOU DARUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap