Calibration product for fragile X syndrome virulence gene detection and application thereof
A disease-causing gene and calibrator technology, which is applied in the field of calibrator for the detection of fragile X syndrome pathogenic genes, can solve the problems of insufficient resolution, long detection time, errors, etc., and achieve improved resolution, perfect and accurate detection methods Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Preparation of Fragile X Syndrome Causative FMR1 Gene Detection Calibrator
[0027] 1. Raw materials
[0028] Four kinds of fragile X syndrome cell lines (GM06905 repeat number 23 / 77, GM20232 repeat number 46, GM20233 repeat number 117, GM20236 repeat number 31 / 53) were purchased from Coriell Institute for Medical Research and prepared as fragile X syndrome gene detection calibrator raw materials. The above cell lines were cultured according to the instructions.
[0029] 2. Genomic DNA extraction
[0030] The cultured cells were extracted using the Genomic DNA Extraction Kit from QIAGEN, and the DNA concentration was measured using Qubit 3.0.
[0031] 3. Preparation of calibrator
[0032] According to the concentration measured in step 2, 10 μg of genomic DNA from each cell line was mixed to obtain the required calibrator.
Embodiment 2
[0033] Example 2 Detection of Fragile X Syndrome Gene Detection Calibrator
[0034] 1, use the calibrator that embodiment 1 makes, carry out PCR reaction according to following system and condition:
[0035] PCR reaction system: Prepare a 20 μL PCR reaction system in a 200 μL thin-walled PCR tube. The PCR amplification system is as follows:
[0036]
[0037]
[0038] Among them, the primers involved are shown in Table 1 below:
[0039] Table 1 Primer Sequence
[0040] Upstream primer F sequence
FAM-TCAGGCGCTCAGCTCCGTTTCGGTTTCA (SEQ ID NO. 1)
downstream primer R sequence
AAGCGCCATTGGAGCCCCGCACTTCC (SEQ ID NO. 2)
[0041] Composition of PCR enhancer: 4 μL of betaine (5 mol / L), 1.2 μL of DMSO.
[0042] PCR reaction program: 98°C pre-denaturation for 10 min, followed by 33 cycles: denaturation at 97°C for 35 s, annealing at 62°C for 35 s, extension at 68°C for 4 min, and final extension at 68°C for 10 min.
[0043] 2. Detection of PCR amplifi...
Embodiment 3
[0047] Example 3 Application of Calibrator in Detection of Fragile X Syndrome Related Gene FMR1
[0048] 1. Sample collection: Collect peripheral blood samples from 4 patients with known Fragile X Syndrome, and use QIAGEN's Genomic DNA Extraction Kit to extract.
[0049] 2. According to the detection method of Example 2, the calibrator and 4 samples were detected, and the standard curve formula y=0.3396x-78.742 (R 2 =0.9999), the detection peak diagram is as follows Figure 3-6 As shown, the results are shown in Table 2 below, and the type is consistent with the original type.
[0050] The number of CGG repeats of the samples in Table 2
[0051]
[0052]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



