Method for establishing luciferase knock-in cell line based on CRISPR-targeted genome modification technology

A luciferase and cell line technology, applied in the field of molecular biology, can solve problems such as cumbersome process, unfavorable high-throughput screening, and difficulty in accurately reflecting gene expression

Inactive Publication Date: 2018-09-21
SHAANXI NORMAL UNIV
View PDF9 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The RT-PCR process is cumbersome and unstable, and Western Blot antibody labeling is time-consuming and expensive, which are not conducive to high-throughput screening; due to the epigenetic modification of the genome itself, the method of cloning the promoter into the expression detection vector carrying the reporter gene cannot Simulate the real state of the genome, so it is difficult to accurately reflect the gene expression on the genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing luciferase knock-in cell line based on CRISPR-targeted genome modification technology
  • Method for establishing luciferase knock-in cell line based on CRISPR-targeted genome modification technology
  • Method for establishing luciferase knock-in cell line based on CRISPR-targeted genome modification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Design, synthesis and vector construction of sgRNA downstream of the stop codon targeting the target gene SREBP1

[0052] (1) Select the downstream of the stop codon of the SREBP1 gene as the targeting region (TSF), with a length of about 1000 bp;

[0053] (2) Find all NGGs and their first 12 bases in the TSF region and perform Blast at NCBI to screen out the sequence that exactly matches the target sequence and the only one (if there is no NGG that meets the requirements, look up CCN in reverse), reducing the potential off-target sites;

[0054] This embodiment designs 4 sgRNAs, wherein:

[0055] The sequence of sgRNA1 is: GTCGAAGCTTTGAAGGCCGA;

[0056] The sequence of sgRNA2 is: GATCTTGACCCTAAGACCGG;

[0057] The sgRNA3 sequence is: GTGGCCGATCGGGGCACTGC;

[0058] The sgRNA4 sequence is: GCTTTCCCGGACTGCAAGCA.

[0059] ACCG was added to its 5' to obtain a forward oligonucleotide, its complementary strand was obtained, and AAAC was added to its 5' to obta...

Embodiment 2

[0060] Example 2: Construction of vectors expressing sgRNA components and Cas9 genes

[0061] (1) After passing the T7E1 detection, select the sgRNA expression vector with high targeting efficiency;

[0062] (2) The sgRNA expression vector with high targeting efficiency and the Cas9 expression vector were digested with KpnI and SpeI respectively, and recovered by agarose gel electrophoresis with a mass concentration of 1%. Excision and sequencing identified positive clones. The obtained clone was named as pCMV-Cas9-SV40pA-U6-sgRNAs-SV40pA (such as figure 1 shown).

Embodiment 3

[0063] Example 3: Construction of the targeting vector pUC19 / SREBP1-donor targeting the SREBP1 gene

[0064] The constructed targeting vector contains two sequences of 909 bp upstream and 887 bp downstream of the targeting break site as the upstream and downstream homology arms of the targeting vector, wherein:

[0065] The upstream homology arm was obtained using primers SREBP1up arm ClaI for sequence TATCGATGTCAGGCAGTGGTGGAGATG and SREBP1up arm SpeI reverse sequence GACTAGTGCTGGAAGTGACAGTGGTCC.

[0066] The downstream homology arms were obtained using primers SREBP1down arm SalⅠfor sequence CGTCGACGGCCACAAGGTACACAACTTT and SREBP1down arm BglⅡ reverse reverse sequence AAGATCTCTGTCCGTCCGTGTCCTCA.

[0067] Then connect it to the pU19 expression vector with the T2A-Luciferase reporter gene, the positive screening element CMV-eGFP-T2A-Neomycin-SV40pA and the negative screening element PGK-TK-T2A-mCherry-SV40pA preserved in our laboratory, and the obtained The vector was named pU...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for establishing luciferase knock-in cell line based on CRISPR-targeted genome modification technology. The knock-in cell line of SREBP1- T2A-Luciferase was established by in situ integration of the 3'end of SREBP1 gene into the T2A-Luciferase reporter gene using CRISPR / Cas9 technique, the fixed point of the Chinese and foreign source genes of the cell line on thegenome is verified. The transcriptional activation of the SREBP1-T2A-Lucifasse cell line was performed using the reported transcription factor LXR Alpha, which has an active effect on the SREBP1. Theresults show that the expression level of the Luciferase in the SREBP1-T2A-Lucifasse cell line can accurately and sensitively reflect the expression level of the SREBP1 in the cell line. The establishment of the cell line will help to study the function of the SREBP1 gene and to screen the small molecular chemical drugs affecting the expression of SREBP1, and provide a new experimental thought and solution for lipid metabolism and related research.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the establishment of cell lines using CRISPR / Cas9-mediated targeted genome insertion technology, in particular to a new method for establishing KI-T2A-Luciferase cell lines based on the CRISPR / Cas9 targeted genome modification technology. Background technique [0002] CRISPR / Cas9 is an immune defense system formed by the long-term evolution of bacteria and archaea. This system uses CRISPR-derived RNA (crRNA) to form a complex with trans-activating RNA through base pairing. Cas9 endonuclease is guided by this complex. Site-directed cleavage of sequences paired with crRNA. Therefore, by artificially designing sgRNA (short guide RNA) with a guiding effect, Cas9 can be guided to perform site-specific cutting of host cell DNA, and then through non-homologous end joining (NHEJ) or homologous recombination (homologous recombination, HR) two repair pathways to repair and realize gene edit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N5/10
CPCC12N5/0603C12N5/0686C12N9/22C12N15/85C12N15/907C12N2510/00C12N2800/107C12N2810/10
Inventor夏海滨李子航赵俊丽
OwnerSHAANXI NORMAL UNIV