Method for building ARID5A-targeted KI-T2A-Luciferase cell line
A cell line, pcmv-cas9-sv40pa-u6-sgrnas-sv40pa technology, applied in the field of molecular biology, can solve the problems that it is difficult to accurately reflect the gene expression of the genome, the real state of the genome cannot be simulated, and there is no ARID5A new reporting system, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1: Design, synthesis and vector construction of sgRNA downstream of the stop codon targeting the target gene ARID5A
[0064] (1) Select the downstream of the stop codon of the ARID5A gene as the targeting region (TSF), with a length of about 1000 bp;
[0065] (2) Find all NGGs and their first 12 bases in the TSF region and perform Blast at NCBI to screen out the sequence that exactly matches the target sequence and the only one (if there is no NGG that meets the requirements, look up CCN in reverse), reducing the potential off-target sites;
[0066] This embodiment designs 4 sgRNAs, wherein:
[0067] The sequence of sgRNA1 is: GTGGGTGGGGCTGCCATTAG;
[0068] The sgRNA2 sequence is: AAGCCTGAGTTGGTCTGCGT;
[0069] The sgRNA3 sequence is: GGTGGTGGATGTAGATTTCT;
[0070] The sgRNA4 sequence is: TTGAAATCACCGGAGGTGCC.
[0071] ACCG was added to its 5' to obtain a forward oligonucleotide, its complementary strand was obtained, and AAAC was added to its 5' to obtain ...
Embodiment 2
[0072] Example 2: Construction of vectors expressing sgRNA components and Cas9 genes
[0073] (1) After passing the T7E1 detection, select the sgRNA expression vector with high targeting efficiency;
[0074] (2) The sgRNA expression vector with high targeting efficiency and the Cas9 expression vector were digested with KpnI and SpeI respectively, and recovered by agarose gel electrophoresis with a mass concentration of 1%. Excision and sequencing identified positive clones. The obtained clone was named as pCMV-Cas9-SV40pA-U6-sgRNAs-SV40pA (such as figure 1 shown).
Embodiment 3
[0075] Example 3: Construction of targeting vector pUC19 / ARID5A-donor targeting ARID5A gene
[0076] The constructed targeting vector contains two sequences of 914bp upstream and 1073bp downstream of the targeting break site as the upstream and downstream homology arms of the targeting vector, wherein:
[0077] The upstream homology arm sequence is:
[0078] CAGCTGTTCACCTCCCAGAGAGTCCCCAGAGCCCCAAAGGGCTGACTGAGAACTCCAGGCACCGGCTGACCCCTCAGGAGGGATTGCAGGCCCCAGGTGGCAGCCTCAGAGAGGAGGCGCAGGCAGGCCCCTGCCCGGCAGCCCCCATCTTCAAGGGCTGCTTCTACACCCACCCCACCGAGGTGCTGAAGCCTGTCAGCCAGCACCCCAGGGACTTCTTCTCTAGACTTAAAGATGGGGTGCTATTGGGGCCTCCTGGCAAAGAGGGGCTGTCAGTGAAAGAGCCCCAGCTGGTGTGGGGCGGAGACGCTAACCGCCCTTCTGCGTTCCATAAAGGTGGCTCCAGAAAGGGCATCCTCTACCCCAAGCCCAAAGCCTGCTGGGTGTCCCCCATGGCCAAGGTCCCAGCCGAGAGCCCCACGCTCCCGCCCACCTTCCCCAGTAGCCCAGGCCTGGGCAGCAAGCGCAGCCTGGAGGAAGAGGGTGCTGCCCACAGTGGGAAGAGACTGCGGGCCGTGTCTCCCTTTCTTAAGGAGGCGGATGCCAAGAAGTGTGGGGCCAAACCTGCAGGGTCCGGCCTGGTCTCCTGCCTTCTGGGCCCAGCCCTGGGGCCTGTGCCCCCAGAGGCCTA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


