Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for building ARID5A-targeted KI-T2A-Luciferase cell line

A cell line, pcmv-cas9-sv40pa-u6-sgrnas-sv40pa technology, applied in the field of molecular biology, can solve the problems that it is difficult to accurately reflect the gene expression of the genome, the real state of the genome cannot be simulated, and there is no ARID5A new reporting system, etc.

Inactive Publication Date: 2019-02-12
SHAANXI NORMAL UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the epigenetic modification of the genome itself, this method cannot simulate the real state of the genome, so it is difficult to accurately reflect the gene expression on the genome
[0004] According to the data search conducted by the applicant, so far, there is no new reporting system for ARID5A, and there are no more literatures on ARID5A transcriptional regulation and new drug screening for reference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for building ARID5A-targeted KI-T2A-Luciferase cell line
  • Method for building ARID5A-targeted KI-T2A-Luciferase cell line
  • Method for building ARID5A-targeted KI-T2A-Luciferase cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Design, synthesis and vector construction of sgRNA downstream of the stop codon targeting the target gene ARID5A

[0064] (1) Select the downstream of the stop codon of the ARID5A gene as the targeting region (TSF), with a length of about 1000 bp;

[0065] (2) Find all NGGs and their first 12 bases in the TSF region and perform Blast at NCBI to screen out the sequence that exactly matches the target sequence and the only one (if there is no NGG that meets the requirements, look up CCN in reverse), reducing the potential off-target sites;

[0066] This embodiment designs 4 sgRNAs, wherein:

[0067] The sequence of sgRNA1 is: GTGGGTGGGGCTGCCATTAG;

[0068] The sgRNA2 sequence is: AAGCCTGAGTTGGTCTGCGT;

[0069] The sgRNA3 sequence is: GGTGGTGGATGTAGATTTCT;

[0070] The sgRNA4 sequence is: TTGAAATCACCGGAGGTGCC.

[0071] ACCG was added to its 5' to obtain a forward oligonucleotide, its complementary strand was obtained, and AAAC was added to its 5' to obtain ...

Embodiment 2

[0072] Example 2: Construction of vectors expressing sgRNA components and Cas9 genes

[0073] (1) After passing the T7E1 detection, select the sgRNA expression vector with high targeting efficiency;

[0074] (2) The sgRNA expression vector with high targeting efficiency and the Cas9 expression vector were digested with KpnI and SpeI respectively, and recovered by agarose gel electrophoresis with a mass concentration of 1%. Excision and sequencing identified positive clones. The obtained clone was named as pCMV-Cas9-SV40pA-U6-sgRNAs-SV40pA (such as figure 1 shown).

Embodiment 3

[0075] Example 3: Construction of targeting vector pUC19 / ARID5A-donor targeting ARID5A gene

[0076] The constructed targeting vector contains two sequences of 914bp upstream and 1073bp downstream of the targeting break site as the upstream and downstream homology arms of the targeting vector, wherein:

[0077] The upstream homology arm sequence is:

[0078] CAGCTGTTCACCTCCCAGAGAGTCCCCAGAGCCCCAAAGGGCTGACTGAGAACTCCAGGCACCGGCTGACCCCTCAGGAGGGATTGCAGGCCCCAGGTGGCAGCCTCAGAGAGGAGGCGCAGGCAGGCCCCTGCCCGGCAGCCCCCATCTTCAAGGGCTGCTTCTACACCCACCCCACCGAGGTGCTGAAGCCTGTCAGCCAGCACCCCAGGGACTTCTTCTCTAGACTTAAAGATGGGGTGCTATTGGGGCCTCCTGGCAAAGAGGGGCTGTCAGTGAAAGAGCCCCAGCTGGTGTGGGGCGGAGACGCTAACCGCCCTTCTGCGTTCCATAAAGGTGGCTCCAGAAAGGGCATCCTCTACCCCAAGCCCAAAGCCTGCTGGGTGTCCCCCATGGCCAAGGTCCCAGCCGAGAGCCCCACGCTCCCGCCCACCTTCCCCAGTAGCCCAGGCCTGGGCAGCAAGCGCAGCCTGGAGGAAGAGGGTGCTGCCCACAGTGGGAAGAGACTGCGGGCCGTGTCTCCCTTTCTTAAGGAGGCGGATGCCAAGAAGTGTGGGGCCAAACCTGCAGGGTCCGGCCTGGTCTCCTGCCTTCTGGGCCCAGCCCTGGGGCCTGTGCCCCCAGAGGCCTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for building an ARID5A-targeted KI-T2A-Luciferase cell line. The method is characterized in that DSBs (double strand breaks) generated at the 3' end of an ARID5A geneon a genome by a CRISPR / Cas9 system are used; a Donor DNA is added into a Cas9-sgRNA ingredient; homologous sequences at two ends of target sites exist on the Donor DNA; DSBs restoration is performedby using the Donor DNA as a template; further, a reporter gene is inserted into the 3' end of the ARID5A; the single stable HEK293-ARID5A-T2A-luciferase-KI cell line is obtained. The result shows thatthe Luciferase expression level in the HEK293-ARID5A-T2A-Luciferase cell line can accurately and flexibly reflect the ARID5A molecular expression level in the cell line, thus facilitating the ARID5Agene function study and screening the upstream transcription factor or micromolecule chemical medicine influencing the ARID5A expression; a novel solution is provided for the further study on the ARID5A relevant autoimmunity process and inflammatory reaction regulation.

Description

technical field [0001] The invention belongs to the fields of molecular biology and pharmacology, and relates to the construction of cell lines, in particular to a method for constructing KI-T2A-Luciferase cell lines targeting ARID5A. Background technique [0002] ARID5A (AT-rich interaction domain 5A), a member of the ARID protein family, has multiple functions and plays an important role in development, tissue-specific gene expression and cell growth regulation. Among them, ARID5A, as an RNA-binding protein, can bind to the stem-loop structure in the 3'UTR of selective inflammation-related mRNAs (such as IL6, STAT3 and TBX21) to inhibit mRNA degradation activity, increase IL6 levels, and participate in inflammatory regulatory responses. Research suggests that this process may be linked to autoimmune processes. [0003] At present, the reporter gene system based on the detection of cell transcriptional activation is a common method for establishing drug screening models. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/90C12N5/10
CPCC07K14/47C12N15/85C12N15/907C12N2800/80C12N2810/10
Inventor 夏海滨黎维康
Owner SHAANXI NORMAL UNIV