Gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as preparation method and application of recombinant streptomyces
A technology for mirbemycin and streptomyces, which is applied in the field of bioengineering and can solve problems such as difficulty in separation and purification of mirbemycin
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] Example 1. Preparation method of kelC, kelD gene inactivated recombinant Streptomyces.
[0092] 1) Construction of kelC and kelD blocking plasmid pKC4445.
[0093] Using primers kelCDup-f / kelCDup-r and kelCDdown-f / kelCDdown-r respectively, using the Streptomyces bingchenggensis BCWT genome as a template, PCR amplification obtained the homologous recombination left arm fragment of kelC gene (that is, the upstream fragment of kelC ) and the right arm fragment of kelD gene homologous recombination (that is, the downstream fragment of kelD), the primer sequence was synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. (the same below), and the underline represents the restriction endonuclease cutting site (the same below ):
[0094] Primer pair for amplification of the upstream fragment of kelC:
[0095] kelCDup -f:5'CCC AAGCTT ACGCGATACGGCGGATATGTGCT 3'( AAGCTT is HindIII restriction site);
[0096] kelCDup -r:5'GC TCTAGA ACTCGGTGTCCAGGCTGGTGGTGG 3'( TCTAG...
Embodiment 2
[0107] Example 2. The preparation method of recombinant Streptomyces in which the kelC gene is individually inactivated.
[0108] Using the same principle, with reference to the construction method described in Example 1, a separate inactivated yellow-green pigment biosynthetic gene cluster (such as figure 1 Shown) is the recombinant vector of the kelC gene, and other steps refer to step 2) to obtain recombinant Streptomyces in which the kelC gene is independently inactivated.
[0109] Primers used for PCR amplification of kelC gene homologous recombination left arm fragment:
[0110] The upstream primer is: kelCDup-f:5'CCC AAGCTT ACGCGATACGGCGGATATGTGCT 3'
[0111] The downstream primer is: kelCDup-r:5'GC TCTAGA ACTCGGTGTCCAGGCTGGTGGTGG 3'
[0112] Primers used for PCR amplification of the right arm fragment of homologous recombination of kelC gene:
[0113] The upstream primer is: kelCdown-f:5'CG GAATTC CACCGCCAACCTCCACGAAC 3'
[0114] The downstream primer is: kel...
Embodiment 3
[0116] Example 3. Preparation method of recombinant Streptomyces in which kelD gene is individually inactivated.
[0117] Using the same principle, with reference to the construction method described in Example 1, a separate inactivated yellow-green pigment biosynthetic gene cluster (such as figure 1 Shown) is the recombinant vector of the kelD gene, and other steps refer to step 2) to obtain the recombinant Streptomyces in which the kelD gene is inactivated separately.
[0118] Primers used for PCR amplification of kelD gene homologous recombination left arm fragment:
[0119] The upstream primer is: kelDup-f:5'CCC AAGCTT TGTCCCGCATATCGAGAAGG 3'
[0120] The downstream primer is: kelDup-r:5'GC TCTAGA GGTGTTGACGGCGTAGAACC 3'
[0121] Primers used for PCR amplification of the right arm fragment of homologous recombination of kelD gene:
[0122] The upstream primer is: kelDdown-f:5'CG GAATTC CGGTTACGCCGCCACCTTCG 3'
[0123] The downstream primer is: kelDdown-r:5'GC T...
PUM
Property | Measurement | Unit |
---|---|---|
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap