Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as preparation method and application of recombinant streptomyces

A technology for mirbemycin and streptomyces, which is applied in the field of bioengineering and can solve problems such as difficulty in separation and purification of mirbemycin

Active Publication Date: 2018-11-06
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the current problem of difficult separation and purification of milbemycin, and the present invention provides a gene cluster that regulates the synthesis of milbemycin, the gene cluster includes kelC gene, kelD gene and kelE gene; the gene kelC, Its nucleotide sequence is shown in SEQ ID No.1, and its encoded protein amino acid sequence is shown in SEQ ID No.4; The gene kelD, whose nucleotide sequence is shown in SEQ ID No.2, encodes The amino acid sequence of the protein is shown in SEQ ID No.5; the nucleotide sequence of the gene kelE is shown in SEQ ID No.3, and the amino acid sequence of the protein encoded by it is shown in SEQ ID No.6

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as preparation method and application of recombinant streptomyces
  • Gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as preparation method and application of recombinant streptomyces
  • Gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as preparation method and application of recombinant streptomyces

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Example 1. Preparation method of kelC, kelD gene inactivated recombinant Streptomyces.

[0092] 1) Construction of kelC and kelD blocking plasmid pKC4445.

[0093] Using primers kelCDup-f / kelCDup-r and kelCDdown-f / kelCDdown-r respectively, using the Streptomyces bingchenggensis BCWT genome as a template, PCR amplification obtained the homologous recombination left arm fragment of kelC gene (that is, the upstream fragment of kelC ) and the right arm fragment of kelD gene homologous recombination (that is, the downstream fragment of kelD), the primer sequence was synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. (the same below), and the underline represents the restriction endonuclease cutting site (the same below ):

[0094] Primer pair for amplification of the upstream fragment of kelC:

[0095] kelCDup -f:5'CCC AAGCTT ACGCGATACGGCGGATATGTGCT 3'( AAGCTT is HindIII restriction site);

[0096] kelCDup -r:5'GC TCTAGA ACTCGGTGTCCAGGCTGGTGGTGG 3'( TCTAG...

Embodiment 2

[0107] Example 2. The preparation method of recombinant Streptomyces in which the kelC gene is individually inactivated.

[0108] Using the same principle, with reference to the construction method described in Example 1, a separate inactivated yellow-green pigment biosynthetic gene cluster (such as figure 1 Shown) is the recombinant vector of the kelC gene, and other steps refer to step 2) to obtain recombinant Streptomyces in which the kelC gene is independently inactivated.

[0109] Primers used for PCR amplification of kelC gene homologous recombination left arm fragment:

[0110] The upstream primer is: kelCDup-f:5'CCC AAGCTT ACGCGATACGGCGGATATGTGCT 3'

[0111] The downstream primer is: kelCDup-r:5'GC TCTAGA ACTCGGTGTCCAGGCTGGTGGTGG 3'

[0112] Primers used for PCR amplification of the right arm fragment of homologous recombination of kelC gene:

[0113] The upstream primer is: kelCdown-f:5'CG GAATTC CACCGCCAACCTCCACGAAC 3'

[0114] The downstream primer is: kel...

Embodiment 3

[0116] Example 3. Preparation method of recombinant Streptomyces in which kelD gene is individually inactivated.

[0117] Using the same principle, with reference to the construction method described in Example 1, a separate inactivated yellow-green pigment biosynthetic gene cluster (such as figure 1 Shown) is the recombinant vector of the kelD gene, and other steps refer to step 2) to obtain the recombinant Streptomyces in which the kelD gene is inactivated separately.

[0118] Primers used for PCR amplification of kelD gene homologous recombination left arm fragment:

[0119] The upstream primer is: kelDup-f:5'CCC AAGCTT TGTCCCGCATATCGAGAAGG 3'

[0120] The downstream primer is: kelDup-r:5'GC TCTAGA GGTGTTGACGGCGTAGAACC 3'

[0121] Primers used for PCR amplification of the right arm fragment of homologous recombination of kelD gene:

[0122] The upstream primer is: kelDdown-f:5'CG GAATTC CGGTTACGCCGCCACCTTCG 3'

[0123] The downstream primer is: kelDdown-r:5'GC T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene cluster for regulating and controlling synthesis of milbemycins, recombinant streptomyces as well as a preparation method and application of the recombinant streptomyces, belongs to the technical field of bioengineering and provides the gene cluster for synthesis of the milbemycins aiming to the problem of difficulty in separation and purification of the milbemycinsat present. The gene cluster includes a kelC gene, a kelD gene and a kelE gene. The invention also provides the recombinant streptomyces, relative to an original strain for producing the recombinant streptomyces, at least one of the kelC gene, the kelD gene and the kelE gene in a genome is inactivated. The invention also provides a construction method of the recombinant streptomyces and a method of using the recombinant streptomyces to produce the milbemycins. The gene cluster is suitable for production and purification of the milbemycins.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a gene cluster regulating the synthesis of milbemycin, a recombinant streptomyces and a preparation method and application thereof. Background technique [0002] Biopharmaceuticals, especially macrolides, are being and are increasingly being used in veterinary medicine and agriculture. Milbemycin is one of the representative commercialized pesticides and veterinary drugs with broad-spectrum inhibition of pests and good eco-friendliness. Milbemycin is a class of sixteen-membered macrolide antibiotics with a chemical structure similar to abamectin. Milbemycin was first discovered in Japan in 1967, and was first registered as an acaricide in Japan for pest control of crops and commercial crops. It was then registered in Australia in 2006 as an acaricide against the flower-concentrating Tetranychus urticae. Up to now, milbemycin has been approved in 43 countries and regions...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/76C12P17/18C12R1/465
CPCC12N9/1029C12P17/181
Inventor 向文胜王海燕刘雨晴成旭王相晶张继
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products