Mesothelin-targeted embedded antigen receptor, method for performing two kinds of modification on Mesothelin-targeted embedded antigen receptor, and purpose thereof
A single-chain antibody, fusion protein technology, applied in genetically modified cells, used to target specific cell fusion, polypeptides containing localization/targeting motifs, etc. Issues such as T cell attack
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] Example 1: Determination of Meso CAR-tEGFR-aPD1 gene sequence
[0086] The heavy chain and light chain variable region gene sequence information (SS1) of the anti-Mesothelin antibody was searched from the NCBI website database, and the sequence was codon-optimized on the website http: / / sg.idtdna.com / site to ensure that the encoded amino acid sequence does not It is more suitable for expression in human cells under variable conditions.
[0087] See SEQENCE LISTING (SEQUENCE ID NO.1-2) for each amino acid and gene sequence information
[0088] The above sequences were connected sequentially, and different enzyme cutting sites were introduced at the junctions of each sequence to form the complete MesoCAR-tEGFR-aPD1 gene sequence information.
Embodiment 2
[0089] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of CAR molecule
[0090] The nucleotide sequence of the CAR molecule prepared in Example 1 was double-digested by NotI (NEB) and EcoRI (NEB), connected by T4 ligase (NEB) and inserted into the NotI-EcoRI position of the retroviral RV (MSCV) vector point, transformed into competent E.coli (DH5α), the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing result was compared with the fitted Meso CAR-tEGFR-aPD1 sequence to verify whether the sequence was correct. The sequencing primers are:
[0091] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUENCE ID NO.3)
[0092] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUUNCE ID NO.4)
[0093] After the sequencing was correct, the plasmid was extracted and purified using a plasmid purification kit from Qiagen, and the purified plasmid was transfected into 293T cells by the plasmid calcium phos...
Embodiment 3
[0095] Example 3: Retroviral Packaging
[0096] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Plate with 0.6*10^6 cells / ml, add 10ml of DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees;
[0097] 2. On the second day, the confluence of 293T cells reaches about 90% for transfection (usually about 14-18 hours after plating); prepare plasmid complexes, the amount of various plasmids is 12.5ug for Retro backbone, 10ug for Gag-pol, and 10ug for VSVg 6.25ug, CaCl 2 250ul,H 2 O is 1ml and the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash it with PBS, and add pre-warmed fresh medium again.
[0098] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um filter...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More