Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primers, probes and kit used for human colorectal tumor specific methylation detection and application of primers and probes used for human colorectal tumor specific methylation detection

A technology for colorectal tumors and detection kits, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve problems such as poor specificity, low stability and repeatability of detection results, and low sensitivity and other problems, to achieve high accuracy, sensitivity and non-invasive, sensitive and good results

Inactive Publication Date: 2018-11-23
HANGZHOU HEYI GENE TECH
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Existing methods for detecting SFRP2 gene methylation have certain problems such as poor specificity and low sensitivity, and the detection results are easily affected by early sample extraction and sulfite conversion, etc., resulting in the stability and reliability of the detection results. low repeatability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probes and kit used for human colorectal tumor specific methylation detection and application of primers and probes used for human colorectal tumor specific methylation detection
  • Primers, probes and kit used for human colorectal tumor specific methylation detection and application of primers and probes used for human colorectal tumor specific methylation detection
  • Primers, probes and kit used for human colorectal tumor specific methylation detection and application of primers and probes used for human colorectal tumor specific methylation detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Establishment of primers and probes for human colorectal tumor-specific methylation detection

[0042] The primers and probes used for the specific methylation detection of human colorectal tumors of the present invention are designed according to the whole human genome sequence published by NCBI (National Center for Biotechnology Information), using Beacon Designer 8, and prepared by a professional DNA sequencer. Synthesis Company Synthesis.

[0043] SFRP2 forward primer: 5-CGCGTTTTAGTCGTCGGTTGTTAGTT-3 (SEQ ID NO.1)

[0044] SFRP2 reverse primer: 5-AAAACGAAACGACCGAAATTCGAAC-3 (SEQ ID NO.2)

[0045] SFRP2 probe: 5-TTATCCCGAACCCGCTCTCTTCGCTAA-3 (SEQ ID NO. 3).

Embodiment 2

[0046] Example 2: A Real-time PCR methylation detection kit for human colorectal tumors

[0047] The kit includes the following primer sequences and probes, the sequences of which are:

[0048] SFRP2 forward primer: 5-CGCGTTTTAGTCGTCGGTTGTTAGTT-3 (SEQ ID NO.1)

[0049] SFRP2 reverse primer: 5-AAAACGAAACGACCGAAATTCGAAC-3 (SEQ ID NO.2)

[0050] SFRP2 probe: 5-TTATCCCGAACCCGCTCTCTTCGCTAA-3 (SEQ ID NO. 3).

[0051] The kit also includes primers and probes for internal reference genes, the nucleotide sequences of which are as follows:

[0052] Internal reference gene forward primer: GGAGGTAATTAGGATGGTGTGGTT

[0053] Internal reference gene reverse primer: CATCRCCCCACTTAATTTTAAAAA

[0054] Internal reference gene probe: TGGGTATATGGTAATTTTGT

[0055] The kit also includes 5ml PCR premix reagent and 5ml nuclease-free double distilled water.

Embodiment 3

[0056] Example 3: Application of the kit of the present invention in the detection of human colorectal tumors

[0057] 1. DNA extraction process from feces (use Q brand commercial extraction reagents, operate according to kit instructions)

[0058] Take 51 stool samples and extract DNA according to the following steps, and a total of 51 DNAs are extracted.

[0059] (1) Add 0.25g feces to the dry lysis tube, then add 750ul lysis bead solution, and vortex gently to mix;

[0060] (2) Add 60 μl of C1 solution, invert up and down several times or gently vortex to mix, and heat in a water bath at 65°C for 10 minutes;

[0061] (3) Place the cracking tube horizontally on the vortex adapter, and vortex continuously at the maximum speed for 10 minutes;

[0062] (4) Centrifuge the lysis tube at 13000 g for 1 min, transfer the supernatant to a 2ml collection tube, and obtain about 400 μl supernatant, then add 250 μl C2 solution, vortex gently, and incubate at 4°C for 5 min;

[0063] (5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to primers and probes used for human colorectal tumor specific methylation detection and application thereof and a kit used for human colorectal tumor specific methylation detection. According to the technical scheme, for a promoter high GC area of a human genome SFRP2 gene, a pair of the methylation specific Real-time PCR primers and the corresponding probes are designed. The primers and the probes are adopted for conducting Real-time PCR detection on a to-be-detected sample subjected to sulfite transformation, according to an amplification result, whether or not the to-be-detected sample is an SFRP2 gene methylation sample is judged, and then whether or not the to-be-detected sample is a colorectal tumor sample is judged. The primers and the probes used for human colorectal tumor specific methylation detection and the application thereof and the kit used for human colorectal tumor specific methylation detection have the beneficial effects that the specificity ishigh, wherein a colorectal tumor specific marker is adopted, and the specificity of colorectal tumor detection is up to 92.3%; the sensitivity is high, wherein the total sensitivity of colorectal tumor detection is 76.3%, specifically, the sensitivity of colorectal cancer detection is 84.6%, and the sensitivity of precancerous lesion detection is 58.3%.

Description

technical field [0001] The invention belongs to the field of disease screening and detection, and in particular relates to a primer, a probe, a kit and an application thereof for detecting specific methylation of human colorectal tumors. Background technique [0002] The morbidity and mortality of colorectal cancer rank third and fourth among all cancers in the world, with about 1.36 million new cases of colorectal cancer and 694,000 deaths from colorectal cancer every year. In China, cancer morbidity and mortality are increasing. It is estimated that in 2015, there were 376,300 new cases of colorectal cancer in China, and 191,000 deaths, ranking fifth among all cancers. Colorectal cancer mainly occurs in people over the age of 50, and the older you are, the higher the risk of cancer. The development of most colorectal tumors goes through multiple stages, including the gradual accumulation of a series of histological, morphological, and genetic mutations. The accumulated ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/154C12Q2523/125C12Q2563/107C12Q2561/113
Inventor 王军一肖雯刘杰王巍洪小平王兆宝
Owner HANGZHOU HEYI GENE TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More