Composition and kit for detecting polymorphism of human MDR1 gene, sample treatment method and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for gene polymorphism and detection reagents, applied in nucleic acid detection and biomedical fields, can solve the problems of increasing false positive rate and false negative rate, time-consuming and laborious, and increasing operation steps
Inactive Publication Date: 2019-02-01
湖南健基生物技术有限公司
View PDF8 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
These techniques must go through tedious nucleic acid extraction and purification processes to obtain higher purity template DNA
Increase the operation steps, time-consuming and labor-intensive, and increase the false positive rate and false negative rate caused by human error
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1 3
[0086] Example 1 triple detection
[0087] Using the above method to detect the sample, the results are as follows: figure 1 As shown, the genotype is 3435CT, 2677GG, 1236CC.
[0088] exist figure 1 In the figure, the rightmost line in the figure shall prevail, and the lines from top to bottom are fluorescent markers: ROX, FAM, CY5, and HEX.
[0089] exist figure 2 In the figure, the rightmost line in the figure shall prevail, and the lines from top to bottom are fluorescent markers: FAM, ROX, HEX, and CY5.
Embodiment 2 3
[0090] Example 2 triple detection
[0091] Using the above method to detect the sample, the results are as follows: figure 2 As shown, the genotype of the sample is 3435CC, 2677GG, 1236CC.
[0092] exist image 3 In the figure, the rightmost line in the figure shall prevail, and the lines from top to bottom are fluorescent markers: ROX, FAM, CY5, and HEX.
[0093] exist Figure 4 In the figure, the rightmost line of the figure shall prevail, and the lines from top to bottom are fluorescent markers: ROX, CY5, HEX, and FAM.
[0094] Hunan Jianji Biotechnology Co., Ltd.
[0095] A composition, kit, sample processing method and application for detecting human MDR1 gene polymorphism
[0096] 15
[0097] 1
[0098] 22
[0099] DNA
[0100] Artificial sequence
[0101] 1
[0102] aggtgctgagtgggcagacggt 22
[0103] 2
[0104] 19
[0105] DNA
[0106] Artificial sequence
[0107] 2
[0108] ctggtagttcttgtagcgc 19
[0109] 3
[0110] 19
[0111] DNA
[0112] A...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to a composition and kit for detecting polymorphism of a human MDR1 gene, a sample treatment method and an application thereof. The composition comprises primers for detecting polymorphism of the 1236 site of the human MDR1 gene and the primers are shown in the formulas of SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4. Primers for detecting polymorphism of the 2677 site of thehuman MDR1 gene and are shown in the formulas of SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8. Primers for detecting polymorphism of the 3435 site of the human MDR1 gene and are shown in the formulas of SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12. The primers do not interfere with each other, have high specificity, and are excellent in sensitivity and repeatability.
Description
technical field [0001] The invention belongs to the technical field of nucleic acid detection in clinical detection technology in the field of biomedicine, and in particular relates to a composition, a kit, a sample processing method and an application for detecting human MDR1 gene polymorphism. Background technique [0002] Polymerase chain reaction (PCR) technology is one of the most commonly used technologies in current nucleic acid detection. Among them, real-time fluorescent PCR technology using fluorescently labeled taqman probe method has been widely used in nucleic acid detection, clinical diagnosis and molecular biology research. Very mature, this technology has been applied to many industries such as laboratory research, food safety, medicine and health, but most of these technologies use a single reaction tube to detect a single target nucleotide, when multiple target nucleotides are detected in a single reaction tube , due to the simultaneous introduction of prim...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more