Supercharge Your Innovation With Domain-Expert AI Agents!

Method for in vivo seamless assembly of DNA

An assembly method, seamless technology, applied in the field of molecular biology, can solve the problem of long time

Inactive Publication Date: 2019-02-26
EAST CHINA UNIV OF SCI & TECH
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method requires the use of three plasmids, two transformations, and takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for in vivo seamless assembly of DNA
  • Method for in vivo seamless assembly of DNA
  • Method for in vivo seamless assembly of DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1, primers and method design for splicing crtE, crtB and crtI three genes

[0071] In this embodiment, three genes of crtE, crtB and crtI are seamlessly spliced ​​as an example. Positive clones were selected by tetA gene negative screening technique. First use crtE as gene A and crtB as gene B.

[0072] In the present embodiment, the DNA sequence of each gene involved is as follows:

[0073] (1) The promoter sequence used by the tetA gene (SEQ ID NO: 1):

[0074] ATCG TTGACG GCTAGCTCAGTCCTAGG TACAGT GCTAGCTACTAGAGAAAGAGGAGAAATACTAG

[0075] (2) tetA gene sequence (SEQ ID NO: 2):

[0076]ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCCAACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGCAGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGCGCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCACAGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTC...

Embodiment 2

[0131] Embodiment 2, DNA fragment preparation

[0132] according to figure 2 As shown, first perform PCR to amplify the desired DNA sequence. PCR was divided into two rounds.

[0133] 1. The first round

[0134] (1), obtaining the fusion sequence of the crtE sequence and its upstream homologous sequence

[0135] Using the E.coli chromosome as a template, use primers crtE-H-F1 and crtE-H-R1 to amplify the upstream homologous sequence of crtE;

[0136] Using pJK70 as a template, use crtE-F, crtE-R1, crtE-R2 to amplify the crtE sequence;

[0137] Then, the crtE sequence and its upstream homologous sequence were fused together by the method of overlap-PCR.

[0138] (2), obtain the tetA gene sequence

[0139] Using pUCtetA as a template, the tetA gene was amplified using tetA-F1 and tetA-R1.

[0140] (3), obtaining the fusion sequence of crtB and its downstream homologous sequence

[0141] Using pJK70 as a template, use crtB-F1 and crtB-R1 to amplify the crtB sequence;

...

Embodiment 3

[0154] Embodiment 3, induce further verification

[0155] Since the inventor used the assembly of crtE, crtB and crtI as an example, the expression of these three genes can produce lycopene, the inventor cloned the assembled sequence into the vector pJK58, transformed it into E. coli, and induced it with arabinose Express.

[0156] The result is as Image 6 As shown, it can be seen that lycopene is expressed.

[0157] Furthermore, the inventors lysed the bacteria, extracted them with ethyl acetate, and performed LC-MS characterization. The results showed that lycopene was produced. This shows that the inventor's assembling method is correct and can be popularized.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method for in vivo seamless assembly of DNA, and discloses a convenient and easy-operating DNA seamless connection method. With the method of the present invention,the seamless connection among a plurality of DNA fragments can be achieved, or a plurality of DNA fragments can be seamlessly assembled onto chromosomes, and DNA fragments with any lengths can be integrated into intracellular chromosomes.

Description

technical field [0001] The invention belongs to the field of molecular biology, and more specifically, the invention relates to a DNA seamless assembly method in vivo. Background technique [0002] DNA assembly technology is an important link and a key step in the realization of various goals in synthetic biology. According to the environment of assembly, DNA assembly can be divided into in vivo assembly and in vitro assembly. The most common method for in vitro assembly is to use restriction enzymes and ligases. However, this method is not suitable for the assembly of multiple genes or large fragments, because it is limited by the recognition sites of restriction endonucleases. The classification of in vitro assembly techniques developed in recent years mainly includes: ① the combination of ligase chain reaction and PCR (LCR-PCR); ② the combination of overlapping multi-segment short nucleotides and PCR, which is similar to overlap extension PCR (OE-PCR); ③ Use homologous...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
CPCC12N15/1027
Inventor 徐锋庄英萍
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com