Supercharge Your Innovation With Domain-Expert AI Agents!

Application and breeding method of serpinA3 and vitronectin gene in breeding of Sujiang boar

A gene and boar technology, applied in the field of Sujiang boar breeding, can solve problems such as the impact of body weight on feed efficiency, uncertainty in energy measurement, and fluctuations in feed intake, so as to save pig raising cycle, Accurate and rapid selection, high feed efficiency results

Active Publication Date: 2019-02-26
JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the evaluation of feed efficiency by F / G or G / F index has the following defects: First, the amount of feed used should be the actual feed intake of pigs, rather than the general feed consumption. How to accurately measure feed intake is a challenge Difficulties, even different trough designs can cause fluctuations in feed intake [2] ; Second, body weight has an impact on feed efficiency, because individuals with different body weights have different energy requirements for maintenance, and individuals with low maintenance requirements have higher feed efficiency [3] ; thirdly, dietary energy level has an impact on feed efficiency due to uncertainty in feed quality (steady energy intake) and energy determination in the diet [4-5]
[0005] However, selection by, or only by, individuals with low RFI levels, i.e., phenotypic selection, has certain limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application and breeding method of serpinA3 and vitronectin gene in breeding of Sujiang boar
  • Application and breeding method of serpinA3 and vitronectin gene in breeding of Sujiang boar
  • Application and breeding method of serpinA3 and vitronectin gene in breeding of Sujiang boar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1. Evaluation of Sujiang boars with low RFI levels

[0069] 1. Determination of phenotypic data

[0070] Select Sujiang back-up boars with an initial body weight of 30KG, a total of 56, and feed rations with reference to the standard given in "Lean Meat Pig Raising Technology" (Zhou Guanghong. Lean Meat Pig Raising Technology. Beijing: Jindun Publishing Society, 2008), the final body weight was 90KG. During the collection of phenotypic data, use the breeding pig performance measurement system or artificial feeding to measure and record the initial test age, average daily gain, average daily feed intake and feed consumption, and use the live backfat meter to measure the backfat thick. The measurement results are shown in Table 1.

[0071] Table 1 Determination results of each character

[0072]

[0073] 2. RFI data model fitting and calculation

[0074] Based on the measurement results of phenotypic data (see Table 1), the optimal RFI model of pigs was an...

Embodiment 2

[0102] Example 2. Screening of alleles that have a significant impact on feed efficiency

[0103] One, collect 220 parts of blood from the Sujiang pig boar used in embodiment 1, utilize Na-OH two-step method to extract DNA, method is as follows: FTA card punches (diameter 1.2mm) sampling, 200 microliters 20mMNaOH soaks Take the blood sample for 30 minutes, absorb the color-changing liquid and add 200 microliters of 1 times TE and let it stand at room temperature for 5 minutes, absorb the residual liquid and perform the following steps after the blood sample is dried.

[0104] 2. Allele typing analysis

[0105] The primers used in PCR amplification are as follows:

[0106] The amplification primer pair (primer pair 1) of serpinA3 gene is:

[0107] Upstream primer (SEQ ID NO 1): AGCCTTTTCACCCTTTCTAGGCCG

[0108] Downstream primer (SEQ ID NO 2): GTAGAGGCTGAAGGCGAAGTCA

[0109] The amplification primer pair (primer pair 2) of vitaminectin gene is:

[0110] Upstream primer (SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering technology, in particular to a method for breeding a Sujiang boar, application of a serpinA3 gene and / or a vitronectin gene in selection of the Sujiang boar, and a kit for selecting the Sujiang boar. The functional relationship between the serpinA3 and vitronectin genes and the feed efficiency of the Sujiang boar is found for the first time. By applying the serpinA3 and vitronectin genes to the breeding of the Sujiang boar, a breeding pig with high feed efficiency can be selected, and the economic benefits of a Sujiang boar farm can beimproved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of serpinA3 and vitaminectin genes in the breeding of Sujiang boars and the breeding method thereof. Background technique [0002] The breeding goal of Sujiang pig is a new breed of pig with high litter size, excellent meat quality and high lean meat rate. After several generations of breeding, the pig has good body shape, appearance, reproduction and production performance [1] . Up to now, feed cost accounts for more than 50% of the total production cost of modern intensive livestock and poultry breeding, and feed efficiency has a significant impact on the economic benefits of large-scale livestock and poultry farming. Feed / Gain (F / G) or weight-to-feed ratio (Gain / Feed, G / F) is usually used at home and abroad, that is, feed conversion rate (Feed conversion rate, FCR) to evaluate feed efficiency. However, the evaluation of feed efficiency by F / G or G...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888
CPCC12Q1/6888C12Q2600/156
Inventor 闫伟赵旭庭周春宝
Owner JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More