Application of serpina3 and vitaminectin genes in the breeding of Sujiang boars and their breeding methods
A gene and boar technology, applied in the application field of Sujiang boar breeding, can solve the problems of uncertainty of energy measurement, fluctuation of feed intake, influence of body weight on feed efficiency, etc. Accurate and rapid selection, high feed efficiency results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. Evaluation of Sujiang boars with low RFI levels
[0069] 1. Determination of phenotypic data
[0070] Select Sujiang back-up boars with an initial body weight of 30KG, a total of 56, and feed rations with reference to the standard given in "Lean Meat Pig Raising Technology" (Zhou Guanghong. Lean Meat Pig Raising Technology. Beijing: Jindun Publishing Society, 2008), the final body weight was 90KG. During the collection of phenotypic data, use the breeding pig performance measurement system or artificial feeding to measure and record the initial test age, average daily gain, average daily feed intake and feed consumption, and use the live backfat meter to measure the backfat thick. The measurement results are shown in Table 1.
[0071] Table 1 Determination results of each character
[0072]
[0073] 2. RFI data model fitting and calculation
[0074] Based on the measurement results of phenotypic data (see Table 1), the optimal RFI model of pigs was an...
Embodiment 2
[0102] Example 2. Screening of alleles that have a significant impact on feed efficiency
[0103] One, collect 220 parts of blood from the Sujiang pig boar used in embodiment 1, utilize Na-OH two-step method to extract DNA, method is as follows: FTA card is punched (diameter 1.2mm) sampling, 200 microliters 20mMNaOH soak Take the blood sample for 30 minutes, absorb the color-changing liquid and add 200 microliters of 1 times TE and let it stand at room temperature for 5 minutes, absorb the residual liquid and perform the following steps after the blood sample is dried.
[0104] 2. Allele typing analysis
[0105] The primers used for PCR amplification are as follows:
[0106] The amplification primer pair (primer pair 1) of serpinA3 gene is:
[0107] Upstream primer (SEQ ID NO 1): AGCCTTTTCACCCTTTCTAGGCCG
[0108] Downstream primer (SEQ ID NO 2): GTAGAGGCTGAAGGCGAAGTCA
[0109] The amplification primer pair (primer pair 2) of vitaminectin gene is:
[0110] Upstream primer ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



