56 results about "Grower pig" patented technology

The invention discloses a real-time cost management and control method and system for a pig raising enterprise. The method comprises the following steps: collecting structured data of a whole breeding period of boars, piglets and pork pigs in real time; based on the structured data, real-time cost indexes of the boars, the piglets and the pork pigs are calculated through a preset algorithm; comparing the real-time cost index with a theoretical standard value based on experimental field data; comparing the real-time cost index with a future cost threshold predicted by machine learning; when the real-time cost index exceeds the theoretical standard value or the future cost threshold value, it is judged that the cost is abnormal; and executing a corresponding exception adjustment operation according to the type of the exception cost. According to the invention, the technical problems of fragmentization of data acquisition, lagging of cost accounting, insufficient anomaly detection precision and low manual response efficiency in the prior art are solved.

The invention belongs to the technical field of animal breeding, and particularly relates to application of a detection reagent of an SNP (Single Nucleotide Polymorphism) molecular marker related to pork tenderness. An SNP site exists at the 232bp position from the 5'end of the sequence, the polymorphism is G / A, three genotypes of GG, GA and AA are shown, G allele is dominant allele, and the meat tenderness of a GG type individual is obviously higher than that of an AA type individual. The invention further develops a reagent for detecting the SNP molecular marker, the reagent can be used for pig assisted breeding, pig breeding or pork tenderness identification, and a method for identifying the pork tenderness is developed, which is beneficial to accelerating genetic breeding and early-stage seed selection of boars with high-quality meat traits.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with pig growth traits and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, and R in the sequence is C or T; one SNP molecular marker site C / T is arranged at the 289bp position of the sequence of the SNP molecular marker. Based on filled high-quality genotype data, an rMVP software package is used for carrying out whole genome association analysis (GWAS) on the character of corrected 100 kg day age (AGE100) of Duroc pigs, one SNP molecular marker site obviously related to the character is screened out, and a new marker resource is provided for molecular breeding of the growth character of the pigs.

This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 8 of pigs and associated with the intramuscular fat trait, and its application. The SNP site of this molecular marker on chromosome 8 corresponds to the T>C mutation at positions 43,738,941 on chromosome 8 in the International Swine Reference Genome Version 11.1. By selecting the dominant allele of this SNP, this invention can increase the frequency of the dominant allele generation by generation, thereby increasing intramuscular fat content, improving meat quality, and breeding superior pigs with the aforementioned traits. This contributes to accelerating the progress of pig genetic improvement and effectively improving the economic benefits of pig breeding.

The invention relates to the technical field of livestock breeding, in particular to a boar mating assisting mating device which comprises an induction mechanism, the induction mechanism is arranged in a shell for boar mating, and the induction mechanism is used for inducing sows to enter the shell; the inducing mechanism comprises a supporting table, a belt conveyor and a food inducing box, the supporting table is fixedly connected into the shell, the belt conveyor is embedded in the middle of the supporting table, and the food inducing box is arranged on the upper surface of the belt conveyor. According to the auxiliary mating equipment for boar mating, the inducing mechanism is arranged, so that a sow can be conveniently induced to enter the shell, the sow can be limited in the shell in advance, in the process of limiting the sow, workers do not need to push the sow into a mating room in a time-consuming and labor-consuming mode, and the labor intensity of the workers is reduced. The sow can actively enter the shell along with the food inducing box under the inducing of the food inducing box, so that the mating process of the boar and the sow can be more convenient.

The utility model relates to the technical field of boar transfer, and discloses a boar transfer cage for black pig breeding. The mounting block is fixedly connected to the left side of the transfer cage; the protection plate is fixedly connected to the left side of the transfer cage; the mounting seat is fixedly connected to the bottom of the transfer cage; and the operation assembly is fixedly connected inside and outside the transfer cage. According to the boar transfer cage for black pig breeding, a water pump is started to convey water in a water tank into a water guide pipe, the water guide pipe conveys the water into a flow dividing pipe through a telescopic water pipe and sprays the water into the transfer cage through a spray head, and meanwhile a motor is started to operate to drive a lead screw to rotate, so that an outer wall sliding frame drives a fixing frame to move left and right, and the fixing frame drives the flow dividing pipe to move left and right; meanwhile, excrement at the bottom in the transfer cage can be washed and flows into a dirt collecting groove through a dirt discharging groove, the cleanliness of the transfer cage is guaranteed, and therefore the comfort degree of the boars is improved.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with correction of a 100kg backfat thickness character of a pig and application of the SNP molecular marker. The SNP molecular marker is located on a pig chromosome 2 and contains six SNP molecular marker sites. Genetic typing is carried out by utilizing a gene chip technology, whole genome association analysis is carried out in combination with the 100kg backfat thickness correction character of the landrace, six SNP molecular markers obviously related to the character are screened out, and a new marker resource is provided for molecular breeding of the growth character of the boar.

The application relates to the technical field of pig breeding, and discloses a breeding method of a grain-saving and environment-friendly type pig, which comprises the following steps: S1, respectively establishing a Duroc pig basic group, a Landrace pig basic group and a Large Yorkshire pig basic group; S2, breeding the pig basic groups in the step S1 by combining variety matching with performance measurement, and respectively establishing a Duroc pig core group, a Landrace pig core group and a Large Yorkshire pig core group; S3, selecting boars and sows from the Duroc pig core group, the Landrace pig core group and the Large Yorkshire pig core group, and performing mating test according to breeding requirements; S4, feeding the offspring of the core groups with the same feed, starting weight and feed consumption measurement when the weight is 25-35 kg, ending when the weight is 95-105 kg, and making records; and S5, repeatedly selecting and breeding in an optimal manner. The application can save breeding cost and feed resources, and reduce greenhouse gas emission and manure pollution.

This invention belongs to the field of black pig breeding technology, specifically relating to a method for breeding large-sized, high-quality black pigs. The method involves crossing purebred Songliao black pigs with purebred Berkshire pigs to obtain F1 generation hybrid pigs. The F1 generation hybrid pigs are backcrossed twice with purebred Songliao black pigs to obtain B2 generation hybrid pigs. The B2 generation hybrid pigs are then crossbred to obtain a basic breeding herd of black pigs. This basic breeding herd is then subjected to closed breeding and successive selection for at least six generations to obtain large-sized, high-quality black pigs. The large-sized, high-quality black pigs of this invention have a Berkshire bloodline content of 12.5%, retaining the high fertility and excellent meat quality of Songliao black pigs, while effectively introducing the growth rate and intramuscular fat deposition advantages of Berkshire pigs. The large-sized, high-quality black pigs of this invention have all-black coats, reach 100kg at ≤175 days of age, have a live intramuscular fat content ≥3.5%, and a litter size ≥10.5 piglets, and can be self-breeding.

The application provides a pig crossbreeding method, an electronic device and a program product, and relates to the technical field of pig breeding. The method comprises the following steps: acquiring a body image of a sow sample in a Jinhua pig strain and a preset pig population; according to the body image, a plurality of excellent samples are selected as target sow samples from the Jinhua pig strain and the preset pig population by a preset sow sample screening strategy; pig performance data of the crossbreeding offspring of the target sow samples are acquired; the comprehensive performance score of the crossbreeding offspring is determined by a preset performance evaluation strategy according to the pig performance data; and the target sow sample corresponding to the crossbreeding offspring with the highest comprehensive performance score is determined as the crossbreeding result according to the comprehensive performance score. In this way, the Jinhua pig strain and a pig breed with fast growth and high lean meat rate are crossbred respectively, and the crossbreeding combination with the optimal offspring performance is selected as the breeding result, so that the advantages of the Jinhua pig and other pig breeds are combined to improve the problems of slow growth and low lean meat rate of the Jinhua pig.

The invention discloses a method for auxiliary identification of Duroc pig growth traits based on a BTG1 region SNP marker, and belongs to the technical field of animal genetic breeding and reproduction. Comprising the following steps: step S1, acquiring a growth trait record of a Duroc pig to be detected, performing data preprocessing, and calculating genetic correlation and phenotypic correlation between heritability and growth traits based on a pedigree; step S2, performing genetic typing on the Duroc pig to be detected, and detecting genotypes of the Duroc pig in a BTG1 region and other key SNP sites; s3, carrying out auxiliary identification on the growth traits of the to-be-detected Duroc pigs on the basis of a pre-established relationship between genotypes and the growth traits; and S4, selecting a corresponding individual as a breeding object according to an auxiliary identification result. The method can be used for early screening and genetic improvement of growth traits such as different day-age weights and staged average daily gain of Duroc pigs, and is suitable for breeding pig breeding practice of large-scale pig farms, live pig breeding enterprises and scientific research institutions.

The utility model discloses a large-scale pig farm boar semen storage device facilitating sampling, and particularly relates to the technical field of large-scale pig farm boar semen storage devices, the large-scale pig farm boar semen storage device comprises a base, a storage box and a storage frame, the storage box is installed at the top end of the base, and the storage frame is movably installed in the storage box; and a test tube rack assembly is arranged on the outer side wall of the storage rack. Through the arrangement of the test tube sleeve, when the test tube is used, the test tube main body filled with the boar semen can be inserted into the inner side of the test tube sleeve to be placed, meanwhile, the fixing bolt on the outer side of the test tube sleeve can be tightened, the front end of the fixing bolt abuts against the surface of the test tube main body, and the test tube main body can be further fixed; and the test tube sleeves are movably mounted on the inner sides of the storage grooves, so that the test tube sleeves and the inserted test tubes can be directly subjected to swinging treatment by virtue of the test tube sleeves, and the use convenience of the boar semen storage device in the large-scale pig farm is realized.

The utility model belongs to the technical field of agricultural equipment, and particularly relates to an automatic growth performance recording device for single experimental pigs. The utility model provides an automatic growth performance recording device which is convenient to use, carries out real-time collection on various data of single pigs, and is particularly suitable for being used in the breeding process of experimental pigs or boars. The multifunctional nursing bed comprises a bed box and is characterized in that a feeding device and a water feeding device are arranged at one end of the upper portion of the bed box, a first weighing device is arranged below the feeding device, and a second weighing device is arranged below the water feeding device; a bearing plate is arranged in the middle of the bed box, and a main weighing device is arranged below the bearing plate; an excrement and urine separating device is arranged in the other end of the bed box, a solid collecting box and a liquid collecting box are arranged in the excrement and urine separating device, a third weighing device is arranged at the bottom of the solid collecting box, and a fourth weighing device is arranged at the bottom of the liquid collecting box.

The application discloses three SNP molecular markers yz_rs329085302, rs320468838 and yz_rs325631013 on chromosome 14 which affect pig teat number, and there are extremely significant differences in left teat number, right teat number and total teat number of pigs with different genotypes of the markers. The three new SNP molecular markers can be used for evaluating pig teat number for non-diagnostic and therapeutic purposes. Compared with the current PCR-RFLP method, the application has the outstanding advantages of simplicity, rapidness, high sensitivity and good specificity.

The invention belongs to the technical field of animal genetic breeding, and particularly relates to a fast-growing high-quality black pig and a breeding method thereof, and the method comprises the following steps: (1) taking Suzhou pigs, Huai pigs and Berkshire pigs as parents, and carrying out three-time hybridization, two-time backcross and cross-cross fixation to produce a black pig basic breeding pig group containing 37.5% Berkshire lineage; and (2) carrying out closed breeding and subculture breeding on the black pig basic breeding pig group to breed a high-quality black pig new germplasm containing 37.5% of Berkshire pig lineage. According to the method, 37.5% of foreign boar blood lineage is introduced through a specific hybridization mode for high-quality local boar resources in China, on the basis that the performance characteristics of good local pork quality, high reproductive capacity, high stress resistance and the like are kept, the growth speed and the meat production rate of the bred pigs are improved through the advantages of the foreign boars, and the requirements of current pig raising production for the fast-growing high-quality black pigs are met.

The invention discloses a method for evaluating the reproductive performance of sows. The reproductive performance is at least one of the number of healthy piglets, the number of weak piglets and the weaning litter weight. According to the specific method, genotypes based on an SNP site 1, an SNP site 3, an SNP site 4, an SNP site 7, an SNP site 10, an SNP site 11 and / or an SNP site 12 in a sow genome are detected, so that the reproductive performance of the sow is evaluated or assisted to be evaluated. The method has the advantages of being reliable in result, high in repeatability and high in accuracy, is suitable for stage-by-stage management of reproductive performance of sows in a pig farm and breeding of boars, and has important application prospects and popularization value in modern breeding.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

This invention relates to the fields of molecular markers and animal genetic breeding technology, and particularly to a SNP marker affecting the total flavor nucleotide content in pigs and its application. Based on three experimental pig populations—purebred American Landrace, purebred American Large White, and purebred American Duroc—this invention employs whole-genome resequencing and GWAS analysis to study and identify nine SNP markers associated with total flavor nucleotides. By optimizing the dominant alleles of these SNPs, the frequency of dominant alleles can be increased generation by generation, thereby increasing the total flavor nucleotide content, improving pork quality, accelerating the progress of pig genetic improvement, and effectively improving the economic benefits of pig breeding.

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to pig daily weight gain on chromosome 1 of pig and application. The site of the SNP molecular marker related to pig daily weight gain on chromosome 1 of pig corresponds to the 162158624th nucleotide site on chromosome 1 of the international pig reference genome 11.1 version, and the base of the site is T or C. Through selecting the dominant allele of the SNP, the dominant allele frequency can be increased generation by generation, the pig daily weight gain is improved, the pig genetic breeding progress is accelerated, and thus the economic benefit of pig breeding is effectively improved.

The present application belongs to the technical field of automatic growth performance determination of pigs, and discloses a kind of sow growth performance determination data correction method, system, equipment and terminal, obtain determination data and are summarized to the determination data table with every pig unit, the determination data table of every pig is matched with the birth information of sow population, obtain the day age, sex, variety information corresponding to every pig;The most suitable intersection between the set formed by calculating each pig during the measurement period (MP) is determined, to determine the most individuals in the whole sow population Correction measurement period;For the missing value of daily weight data and daily feed intake data of each pig in the correction measurement period, fill in the correction, calculate the average daily gain (ADG) and feed conversion ratio (FCR) of each pig in the correction measurement period, calculate the change of body weight of each pig with increasing age in the correction measurement period, and draw the growth curve graph of each pig in the correction measurement period.

The application provides a method for diagnosing and differentiating classical swine fever based on a classical swine fever E2 subunit vaccine, which comprises the following steps: immunizing pigs in a pig farm with the classical swine fever E2 subunit vaccine, detecting E0 antibodies and E2 antibodies after one year of immunization, and eliminating the pigs with E0 antibodies until both the E0 antibodies and the CSFV nucleic acid detection are negative, which indicates that the classical swine fever is purified. The classical swine fever E2 subunit vaccine comprises a nucleic acid fragment encoding an antigen protein with the amino acid sequence of SEQ ID NO: 5 inserted into a recombinant expression vector. The classical swine fever E2 subunit vaccine provided by the application has good immunoprotective efficacy on pigs, and a classical swine fever epidemic disease purification method is established by using the subunit vaccine. The application effect of the method in a pig breeding company for two years shows that the method can effectively purify the classical swine fever, which indicates that the purification method provided by the application is feasible and can be popularized and applied.

The utility model discloses an adjustable local boar limiting delivery fence which comprises a base, four sets of stand columns are fixed to the top of the base, and a fence is fixed between every two adjacent stand columns. Compared with the prior art, the adjusting mechanism is arranged to drive the separation mechanism installed on the side face of the shell to move, the space size of a boar and piglet activity area can be flexibly adjusted according to the body types of sows through the design, and the problems that a traditional delivery fence is fixed in space and cannot adapt to the sows of different body types are solved; stress reaction of large-size sows due to narrow space is avoided, small-size sows can conveniently take care of piglets, safety guarantee is provided for the piglets through the design of the separation mechanisms, the sows can be effectively prevented from entering the piglet activity area and being prevented from crushing the piglets during sow delivery and daily activities by adjusting the height of the transverse rod, and the sow delivery efficiency is improved. The survival rate of the piglets is improved.

The invention discloses a functional site combination for predicting sow reproductive traits and application thereof.The functional site combination comprises 12232 SNP loci, ear tissues of Changbai breeding pigs from a certain pig farm in the south of China are collected, gene chip sequencing and whole genome re-sequencing data are used, and the functional site combination is used for predicting the reproductive traits of sows. A large number of SNP markers are obtained by using a genotype filling technology, functional marker information related to the breeding traits of the landrace sows is screened in combination with multi-omics information, noise sites in filling data are removed, and finally the 10K functional site applied to the breeding traits of the landrace sows is formed. The SNP molecular marker related to the breeding traits of the landrace sows is screened out, a new molecular marker development basis is provided for prediction and genetic improvement of the breeding traits related to the landrace sows, and the SNP molecular marker has important significance in improving the breeding and breeding efficiency of pigs.

The utility model relates to a boar semen collection frame for live pig breeding. Comprising a base plate, a fake sow table and an auxiliary climbing mechanism. A height adjusting electric telescopic rod is arranged at the right end of the base plate, a fake sow table is arranged on a telescopic rod of the height adjusting electric telescopic rod, a front leg lapping rod capable of moving left and right is slidably installed on the fake sow table, and the front leg lapping rod is driven by a left-right adjusting electric telescopic rod arranged in the fake sow table to move; the base plate is provided with an auxiliary climbing mechanism located on the left side of the fake sow table. According to the artificial sow platform, boars can be helped to climb the artificial sow platform through the auxiliary climbing mechanism, meanwhile, the artificial sow platform can ascend and descend, the artificial sow platform can be suitable for boars of different sizes to use, meanwhile, the boars can climb at a short position, then the artificial sow platform is lifted to the designated height, workers can conveniently conduct semen collection work, and in addition, the artificial sow platform is convenient to use. The boars can be assisted to climb towards the right side of the fake sow table through the front leg lapping rods capable of moving left and right, and it is ensured that the boars can climb in place.

The utility model discloses an outdoor boar breeding device which comprises a base and a feed basin, an installation frame and four supporting frames are fixedly installed on the top of the base, a balancing weight is fixedly installed in the base, and two connecting mechanisms are fixedly installed on the side walls of the two ends of the feed basin respectively. And the four connecting mechanisms are connected with the opposite supporting frames in a clamped mode, two second limiting rods are fixedly installed on the side walls of the two ends of the mounting frame, and a limiting mechanism is slidably connected between every two opposite second limiting rods in a penetrating mode. The detachable pig feed basin is reasonable in structural design, the detachable pig feed basin can be rapidly detached when needing to be cleaned, an operator can carry the detached pig feed basin to a water source to clean the pig feed basin, cleaning is convenient, when pigs do not eat feed, the pig feed basin can be shielded, and the pig feed basin is convenient to clean. And the condition that external sundries fall into the feed basin to pollute the feed in the basin is avoided.

The utility model discloses intelligent boar measurement equipment based on image recognition and projection positioning, and aims to solve the problems of low efficiency and low accuracy when the conventional boar measurement equipment is used for measuring various performances of a pig. The system comprises a weighing platform, a cage scale outer frame, an RFID antenna, a binocular depth camera, a B ultrasonic backfat instrument and projection equipment. The binocular depth camera and the projection equipment are located above the cage scale to shoot an overall image of the back of the pig and project an image containing a backfat point to be measured on the back of the pig, the ultrasonic backfat probe is held by hand to press a point indicated by the projection equipment to obtain a backfat ultrasonic image, and a backfat value and an eye muscle thickness value are read; data is transmitted to the cloud server through the controller, so that information management is facilitated; according to the invention, the ear tag number, the body weight, the body length, the body width and the body height can be obtained simultaneously, the measurement of the backfat value and the eye muscle thickness value of the boar can be assisted, errors caused by human factors can be reduced, the manual labor intensity is reduced, the measurement efficiency is high, and the accuracy of boar performance measurement is high.

The invention discloses an information acquisition system for boars, relates to the technical field of boar information acquisition, and is characterized in that the system utilizes technologies and methods such as computer vision, big data and an artificial intelligence algorithm to construct a phenotype big data acquisition and analysis system taking intelligent automatic measurement as a core. The system integrates a boar image data acquisition module, an automatic boar body size measurement module based on a Mama segmentation model, and a non-contact intelligent boar weight and feed conversion ratio measurement module based on an integrated regression model, and realizes intelligent dynamic monitoring and acquisition of important growth traits of boars.

The utility model relates to the technical field of boar transfer, in particular to a boar transfer cage for boar breeding, which comprises a transfer cage body, the inner wall of the transfer cage body is fixedly connected with a protective frame, the lower surface of the inner wall of the protective frame is provided with a pore plate, and the upper surface of the transfer cage body is fixedly connected with a connecting frame. A fixing assembly is arranged in a connecting frame, the left side face and the right side face of the inner wall of a protection frame are fixedly connected with the left side face and the right side face of a movable frame correspondingly, a rotating disc a is rotated to drive a screw a and a screw b to rotate, and the screw a and the screw b rotate to drive two threaded sleeves a, two mounting plates and two air bags to get close to each other. The boars are fixed in the protection frame through the two air bags, the boars are prevented from colliding with the protection frame in the transferring process, and the problems that an existing device lacks the function of assisting in fixing the boars, and the boars may be injured in the transferring vehicle body moving process are solved.

The invention provides a pig hybridization breeding method, electronic equipment and a program product, and relates to the technical field of pig breeding. The method comprises the following steps: acquiring physical images of boar samples in a Jinhua pig strain and a preset pig breed group; screening a plurality of excellent samples from a Jinhua pig strain and a preset pig breed group as target pig samples through a preset pig sample screening strategy according to the physical image; acquiring pig performance data of the filial generation of the target breeding pig sample; according to the pig performance data, through a preset performance evaluation strategy, determining a comprehensive performance score of the filial generation; and according to the comprehensive performance scores, determining a target boar sample corresponding to the filial generation with the highest comprehensive performance score as a hybridization breeding result. Therefore, the Jinhua pig strain and the pig variety with fast growth and high lean meat percentage are respectively subjected to cross breeding, a cross combination with optimal offspring performance is selected as a breeding result, and the problems of slow growth and low lean meat percentage of the Jinhua pigs are improved by combining the advantages of the Jinhua pigs and other pig varieties.

The utility model relates to the technical field of boar breeding, in particular to an isolation equipment assembly with a quick release function, which comprises a left cover plate, a rotating shaft is mounted on one side of the left cover plate, a right cover plate is mounted on one side of the rotating shaft, a main slot is arranged on one side of the right cover plate, a fixing plate is mounted at one end of the left cover plate, and a clamping groove is formed in one side of the fixing plate. A fixing shell is installed on one side of the fixing plate, a pull rod is installed on the inner wall of the fixing shell, a telescopic spring is attached to one side of the pull rod, a baffle is attached to the bottom of the pull rod, an isolation door is attached to the other end of the left cover plate, a fixing inserting block is connected to the bottom of a bolt, and an auxiliary sliding block is attached to one end of the isolation door. According to the improved isolation equipment assembly, the fixed shell and the fixed insertion block are additionally arranged, so that workers can conveniently disassemble and assemble the equipment, the main insertion plate and the rotating shaft are additionally arranged, and the equipment is convenient to store and transport at the same time.