BCMA and CD19-targeted duplex-specific chimeric antigen receptor and application thereof

A chimeric antigen receptor, bispecific technology, applied in the application of anti-tumor therapy, the construction of chimeric antigen receptor T cell technology, can solve the problems of reduced CD19 expression and easy escape from immune mechanisms, etc.

Active Publication Date: 2019-03-19
GUANGZHOU BIO GENE TECH CO LTD
View PDF8 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN 104788573A discloses a chimeric antigen receptor hCD19scFv-CD8α-CD28-CD3ζ and its use. After a CAR-T cell reinfusion of CD19 in this patent, the expression level of CD19 will decrease, and it is easy to escape immunity mechanism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BCMA and CD19-targeted duplex-specific chimeric antigen receptor and application thereof
  • BCMA and CD19-targeted duplex-specific chimeric antigen receptor and application thereof
  • BCMA and CD19-targeted duplex-specific chimeric antigen receptor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Design of chimeric antigen receptor

[0071] This example constructed anti-BCMA and anti-CD19 bispecific chimeric antigen receptors (B(G)19 and 19(G)B), anti-BCMA chimeric antigen receptors and anti-CD19 chimeric antigen receptors , The sequence diagram is as figure 1 As shown, the chimeric antigen receptor includes a CD8α signal peptide sequence (Leader), a bispecific antibody sequence that specifically binds to BCMA and CD19 antigens, an anti-BCMA single domain antibody and an anti-CD19 single domain antibody, CD8α The hinge region (Hinge) and transmembrane region sequence (Transmembrane), 4-1BB costimulatory domain sequence and CD3ζ signaling domain sequence, the specific partial sequences are as follows:

[0072] CD8α signal peptide (leader) amino acid sequence (SEQ ID NO.11): MALPVTALLLPLALLLHAARP;

[0073] CD8α signal peptide (leader) nucleotide sequence (SEQ ID NO.12):

[0074] ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCAGCACGCCCT;

[0075] The amino...

Embodiment 2

[0090] Example 2: Construction of anti-BCMA chimeric antigen receptor expression vector

[0091] (1) Complete gene synthesis of B(G)19CAR, 19(G)B CAR, BCMA CAR, and CD19CAR sequences. Use EcoRI and BamHI to digest the fully synthesized CAR and empty vector. After digestion in 37℃ water bath for 30 minutes , Use 1.5% agarose gel for DNA electrophoresis, and then use Tiangen's agarose gel kit for purification and recovery;

[0092] (2) Connection between pLVX-EF1-MCS vector and CAR gene fragment:

[0093] The connection system is as follows:

[0094]

[0095]

[0096] After ligation at 22°C for 1 hour, the ligation product was directly transformed into Stbl3 E. coli competent cells. 200 μl of the transformed product was coated on an ampicillin-resistant LB plate. The LB plate was cultured upside down in an incubator at 37°C overnight. Three single clones were randomly selected the next morning for colony PCR identification, and positive clones were sent for sequencing.

[0097] The elem...

Embodiment 3

[0098] Example 3: Lentivirus packaging

[0099] The lentiviral expression vectors in the examples were separately packaged with a four-plasmid system. The specific steps are as follows:

[0100] (1) The four-plasmid system expresses the gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, the total mass is 10μg;

[0101] (2) Add the above plasmid to a certain volume of serum-free DMEM, mix well and leave it for 15 minutes, add the above mixture to the T75 culture flask with 293T cells, mix gently, and incubate at 37℃, 5 %CO 2 Culture in a cell incubator for 6 hours;

[0102] (3) After 6 hours, replace the fresh medium, continue the culture, and add 10 mM sodium butyrate solution. After 72 hours, collect the culture supernatant of the lentivirus for purification detection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a BCMA and CD19-targeted duplex-specific chimeric antigen receptor and application thereof. The chimeric antigen receptor comprises an extracellular structural domain, a membrane spanning structural domain and at least one intracellular structural domain which can be bound with an antigen, wherein the extracellular structural domain comprises an anti-BCMA antigen structural domain and an anti-CD-19 antigen structural domain. The chimeric antigen receptor has relatively small clinic side effects and relatively high safety, a solid tumor can be effectively shrunk, and the treatment effect of tumors can be effectively improved.

Description

Technical field [0001] The present invention relates to the field of cellular immunotherapy for tumors, in particular to a bispecific chimeric antigen receptor targeting BCMA and CD19 and its application, specifically a chimeric antigen receptor T based on specific targets BCMA and CD19 (CAR-T) cell technology construction method and its application in anti-tumor therapy. Background technique [0002] At present, T cells modified by chimeric antigen receptor (CAR) have achieved gratifying results in clinical trials for the treatment of B-cell malignancies, bringing CAR technology to the treatment of relapsed and refractory multiple myeloma (MM) The dawn. Multiple myeloma is a malignant disease that originates from plasma cells in the bone marrow, and plasma cells are cells that develop to the final functional stage of B lymphocytes. [0003] BCMA (CD269) is expressed in mature B cells and plasma cells, and is also widely expressed in MM. The ADC drug (GSK2857916) and dual-target...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10C12N7/01A61K35/17A61P35/00A61P35/02
CPCA61K35/17A61P35/00A61P35/02C07K14/7051C07K16/2803C07K16/2878C07K2319/02C07K2319/33C12N7/00C12N15/86C12N2510/00C12N2740/15021C12N2740/15043
Inventor李光超郭锦涛丁雯曾剑华罗敏莫文俊
OwnerGUANGZHOU BIO GENE TECH CO LTD