Zyxin gene shRNA inhibiting tumor cell proliferation and migration, recombinant vector and application
A tumor cell proliferation and gene technology, applied in the field of preparation of anti-tumor drugs, can solve the problems of no Zyxin gene proliferation and migration, affecting the treatment effect and prognosis of colorectal cancer patients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Screening and preparation of Zyxin gene efficient interference lentivirus
[0026] The shRNA design for specifically silencing Zyxin (ZYX), construction of expression vectors, lentiviral packaging, and screening and verification of effective strains include the following steps:
[0027] The first step, shRNA fragment sequence design
[0028] According to the human Zyxin gene sequence, three short sequences of Zyxin gene were screened as target sequences, and the corresponding complementary base sequences were designed to form three shRNAs: Zyxin-shRNA1, Zyxin-shRNA2 and Zyxin-shRNA3. The above three shRNA target sequences and their corresponding complementary base sequences are as follows:
[0029] Zyxin-shRNA1 target sequence:
[0030] SEQ ID NO:1 CTTCCACATGAAGTGTTACAA
[0031] Complementary base sequence of Zyxin-shRNA1:
[0032] SEQ ID NO:2TTGTAACACTTCATGTGGAAG
[0033] Zyxin-shRNA2 target sequence:
[0034] SEQ ID NO:4 CTGGGTCACAAACCAAAATCAAA
[0035...
Embodiment 2
[0105] Example 2: Detection of proliferation ability of HCT116 cells stably transfected with lentivirus
[0106] Take the human HCT116 cells infected with the Zyxin-shRNA1 lentivirus provided in Example 1, in a good growth state and in the logarithmic growth phase, and its control, and press 4×10 3 / mL inoculation and 96-well plate, set 5 duplicate wells for each group, place them in an incubator for culture, add 10ul CCK-8 to each well after 24h, 48h, 72h and 96h respectively, mix well and place in culture Continue culturing in the box for 2-4 hours, measure the OD value at a wavelength of 450 nm with a microplate reader, take the average of the experimental results as the final experimental result, and draw the growth curve.
[0107] see attached results image 3 , the results showed that transfection interfered with lentiviral HCT116 cells (attached image 3 After the third day of in vitro culture of HCT116-shZYX) in vitro, the proliferation rate slowed down, which was si...
Embodiment 3
[0108] Embodiment 3: Detection stable transfection interferes with the migration ability of lentivirus HCT116 cells
[0109] Put the Transwell chamber into the culture plate. The chamber is called the upper chamber, and the inside of the culture plate is called the lower chamber. The upper chamber is filled with the culture medium of the upper layer, and the lower chamber is filled with the culture liquid of the lower layer. The upper and lower culture liquids are separated by a polycarbonate membrane. The cells are planted in the upper chamber. Due to the permeability of the polycarbonate membrane, the components in the lower culture medium can affect the cells in the upper chamber, so that the influence of the components in the lower culture medium on cell growth and movement can be studied.
[0110] Take human HCT116 cells infected with Zyxin-shRNA1 lentivirus provided in Example 1, in a good growth state and in logarithmic growth phase, and its control, and adjust the numbe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


