Coronavirus resistant clone pig and preparation method thereof

A coronavirus and resistance technology, applied in the genetic field, can solve the problem of blocking a variety of coronavirus infections, and achieve the effect of resisting swine coronavirus infection

Inactive Publication Date: 2019-04-16
SOUTH CHINA AGRI UNIV +1
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, if the expression of the pAPN gene in pigs can be deleted, it will block the infection of multiple coronaviruses to pigs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coronavirus resistant clone pig and preparation method thereof
  • Coronavirus resistant clone pig and preparation method thereof
  • Coronavirus resistant clone pig and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0021] A method for preparing a coronavirus-resistant cloned pig based on CRISPR / Cas9 gene editing technology, comprising the following steps:

[0022] (1) Obtain gRNA sequences specifically targeting exon 2 and exon 3 of the pAPN gene, the nucleotide sequences of which are shown in sequence as SEQ ID No.1-2;

[0023] Prepare the CRISPR / Cas9 targeting vector corresponding to the gRNA sequence. The preparation method of the CRISPR / Cas9 targeting vector is: digest the PX330 vector with the restriction endonuclease BbsI; synthesize the second exon and the third exon respectively The gRNA positive strand and the complementary strand DNA of the exon, with sequences matching the sticky ends formed by the digested PX330 vector at both ends; the gRNA positive strands of the 2nd exon and 3rd exon with the The complementary strand DNA is mixed separately, and then the mixed sequence is placed in water with a temperature of at least 98-100°C and boiled for 2.5-3.5min, then allowed to sta...

Embodiment 1

[0038] Construction of pAPN gene knockout vector

[0039] 1. Selection and synthesis of targeting sites.

[0040] Select the CRISPR targeting site according to the sequence rules of GN(18-20)GG. The site must be located on the exon downstream of ATG and located in the first 1 / 3 of the coding region, so as to ensure that the introduction of mutations can lead to a more complete protein inactivation. The two selected targeting sites are located on exon 2 and exon 3, respectively, named gRNA2 and gRNA3.

[0041] The lengths are 19bp and 20bp respectively, and the sequences are GGGCTCCTGGCAGATGAAG and GATGTTGAACGTGGCCTTCA respectively. The structure of pAPN gene and the selected target site information are as follows: figure 1 shown. The oligonucleotides used to express gRNA were synthesized according to the selected targeting sites, and the sequences are shown in Table 1.

[0042] Table 1

[0043]

[0044] 2. Construction of pAPN targeting vector.

[0045] The PX330 vec...

Embodiment 2

[0047] Example 2: Screening of pAPN knockout cells

[0048] 1. The primary isolated 30-day pig fetal fibroblasts were cultured to more than 80% confluence, digested and centrifuged to remove the cell culture medium, and then resuspended the cells in PBS to adjust the cell concentration to 10 5 each / 100μl PBS. Take 100 μl of cell suspension, mix with 10 μg of targeting plasmid, and place in Lonza Nucleofector for electroporation and transfection. The electric shock program was selected as A330. After electroporation, the cells were divided into ten 10cm culture dishes, with about 1000 cells per dish, and the culture medium was DMEM+15%FBS at 37°C, 5%CO 2 cultured in an incubator.

[0049] 2. After 10 days of transfection, the cells form a single clone of appropriate size. At this time, single cell clones need to be picked and transferred to a 48-well plate. Continue to culture to 24 wells.

[0050] 3. Remove 1 / 10 of the cells by centrifugation to remove the culture medium,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a coronavirus resistant clone pig based on CRISPR / Cas9 gene editing technology and a preparation method thereof. The preparation method of the clone pig is characterized by comprising the following steps of: (1) obtaining gRNA sequences of a second exon and third exon of a specific targeting pAPN gene, wherein the nucleotide sequencesare shown as SEQ ID No. 1-2 in sequence; preparing CRISPR-Cas9 targeting vectors PX330-pAPN2 and PX330-pAPN3 corresponding to the gRNA sequences; (2) transferring the obtained targeting vector PX330-pAPN2 or targeting vector PX330-pAPN3 into porcine fetal fibroblasts to obtain a pAPN gene editing cell line; (3) carrying out somatic cell nuclear transfer operation on the pAPN gene editing cell line, transferring the reconstructed embryointo a substitute pregnancy receptor, and bearing the clone pig through natural pregnancy. The method can obtain the clone pig with complete deletion expression of porcine coronavirus receptor pAPN,and has the capability of resisting porcine coronavirus infection.

Description

technical field [0001] The invention relates to gene technology, in particular to a coronavirus-resistant cloned pig based on CRISPR / Cas9 gene editing technology and a preparation method thereof. Background technique [0002] CRISPR (Clustered regularly interspaced short palindromic repeats) / CRISPR-associated protein (Cas) 9 system is an adaptive immune system of prokaryotes, which is used to resist the invasion of bacteriophage and foreign genetic material. In recent years, researchers have modified the system to make it applicable to mammalian cells and in vivo. The system is guided by a guide RNA (gRNA) that is consistent with the sequence of the target DNA site, thereby mediating the Cas9 protein to specifically cut the target site, thereby forming a DNA double-strand break. The double-strand break on the genome can significantly improve the efficiency of subsequent gene knockout (Knockout) and gene knockin (Knockin), so that the target site can be modified efficiently,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027
CPCA01K67/0276A01K2207/15A01K2217/07A01K2227/108A01K2267/02C12N9/22C12N15/907
Inventor杨化强张健石俊松吴珍芳
OwnerSOUTH CHINA AGRI UNIV